Transcript asmbl_58667

Sequence
Transcript Sequence for observation asmbl_58667 of TGE0006784:
GCCGGCGGCCATTTTGTGAAGCGGCGGAGGAGGTGGTGGCTGCTGTGGGCTCCGGGAAGCTGTTCGCGCAGGGGCTGTCGGCCGCGGGGCGAAGGCACTCGCGCGGGGGATGGCCCGCTGCGTGACCTTGGTTCAACTGTCCATTTCCTGTGACCACCTCATCGATAAGGACATCGGCTCCAAGTCTGACCCACTCTGTGTCCTTTTACAGGATGTGGGAGGGGGCAACTGGGTTGAGCTTGGCCGAACTGAGCGAGTACGGAACTGCTCGAGCCCTGAGTTCTCCAAGACTCTGCAGCTTGAATATCACTTTGAAACAGTCCAGAAGCTCCGATTTGGCATCTATGACATAGACAACAAGACACCTGAGCTGGGGGATGACGACTTCTTAGGTGGGGCTGAGTGTTCCCTAGGACAGATTGTGTCCAGCCAGATAATAACTCTGCCTTTGATGCTGAAGCCTGGAAAACCTGCTGGGCAGGGGACCATCACGATCTCATCTCAGGAATTGAAGGATAGTCGTGTAGTGACCATGGAGGTGGAAGCCAGAAACCTAGATAAAAAGGACTTCCTGGGGAAATCTGATCCATTCTTGGAGTTCTTCCGCCAGGGTGATGGGAAATGGCACCTGGCATACAGATCTGAGGTAATCAAGAACAACCTGAACCCTGCATGGAAGCGCTTCTCTGTTCCCCTTCAGCATTTCTGTGGGGGAGACCCTAGCACACCTATCCAGGTACGATGCTCAGACTATGACAGTGATGGTTCACATGATCTCATTGGTACCTTCCACACCAGTTTGGCCCAGCTGCAAGCAGCCCCAGCTGAGTTTGAATGCATCCACCCTGAGAAACAGCAGAAAAAGAAAAGCTACAAGAACTCTGGAACTATTCGTGTCAAGATTTGCCAGGTAGAAACAGAGTATTCATTCCTCGACTATGTGATGGGAGGCTGTCAAGTCAACTTTACTGTGGGTGTGGACTTCACAGGCTCCAATGGAGACCCCTCCTCACCAGACTCCCTGCACTACCTGAGCCCAACAGGGGTCAACGAGTACCTGACAGCACTGTGGAGTGTGGGAAGCGTGATTCAGGACTATGATTCGGACAAGCTGTTCCCAGCATTTGGATTTGGGGCTCAAGTGCCCCCTGACTGGCAGGTCTCCCATGAATTTGCTTTGAACTTCAATCCCAGTAACCCCTACTGTTCAGGCATCCAGGGTATTGTGGATGCCTACCGTCAGGCCCTGCCCCAAGTTCGCCTCTATGGCCCCACAAATTTCGCACCCATCATCAACCATGTGGCCAGGTTTGCAGCCCAGGCTGCACAACAGAGGACTGCCTCGCAATACTTTGTGCTGCTGCTGCTAACCGACGGTGCTGTGACAGATGTGGAGGCCACACGTGAGGCTGTGGTTCGTGCCTCCCACCTGCCTATGTCAGTGATCATCGTGGGTGTGGGCGGTGCTGACTTCGAGGCCATGGAGCAGTTGGATGCTGATGGTGGACCCCTGCGCACACGCTCCGGGGAGGGAGCTGCCCGTGACATAGTGCAGTTTGTGCCCTACCGCCGCTTCCAGAATGCCCCTCGAGAGGCATTGGCGCAGACTGTGCTCGCAGAGGTACCCATGCAACTGGTCTCCTACTTCAAGGCCCAAGGCTGGGCCCCATTCAAGCCGCTTCCACTCCCAGCCAAGGGCCCTGCAGAGGCTCCTCAGGCCTAGATTCCCTTGGAGCGTAGGTTATGGCCAGTCCTCAGCCCTGTGTCCCCACCTCTGAACACACTTGCCAGTGCTAGCAGTTTATATATTTTATACTTTTATACTTGCTCCTGCTATTGCTGCTCTTGATCCCACCTGCTTGCCCCCTGGAGCCCTTCATTCAATAAAGATCAACGATGACCACTGCTTTGCCACCACTCTGTTTTTGGGTAGG