Transcript asmbl_57141

Sequence
Transcript Sequence for observation asmbl_57141 of TGE0030958:
GTACTGCGGGGCTGGTTCAGTGTCTGATATCATTCGATTACGAAATAAAACGTTAACAGAAGATGAAATAGCTACAATATTACAATCAACGCTTAAGGGACTGGAATACCTTCATTTTATGAGGAAAATACACCGAGATATCAAGGCAGGAAATATTTTGCTAAATACGGAAGGACATGCAAAACTTGCAGATTTTGGGGTAGCAGGTCAACTTACAGATACCATGGCCAAGCGAAATACAGTGATAGGAACACCGTTTTGGATGGCTCCAGAAGTGATTCAGGAAATTGGGTACAACTGTGTGGCAGACATCTGGTCATTGGGAATAACTGCCATAGAAATGGCTGAAGGAAAGCCCCCATATGCTGATATCCATCCAATGAGGGCAATCTTCATGATTCCTACCAACCCTCCTCCCACATTTCGAAAGCCAGAACTGTGGTCAGATAACTTCATGGATTTTGTGAAGCAGTGTCTTGTAAAGAGCCCTGAGCAGAGAGCCACAGCCACTCAACTCCTACAGCACCCATTTGTCAAGAGTGCCAAAGGAGTGTCGATACTGCGGGACTTAATTAATGAAGCCATGGACGTGAAACTGAAACGCCAGGAAGCCCAGCAGCGGGAGGTGGACCAGGATGATGAAGAAAACTCAGAGGAGGATGAAATGGATTCTGGCACGATGGTTCGAGCAGCAGGTGATGAGATGGGCACTGTCCGAGTAGCCAGCACCATGAGTGATGGAGCCAATACTATGATTGAGCACGATGACACATTGCCATCACAGCTGGGCACCATGGTGATCAATGCAGAGGATGAGGAAGAGGAAGGGACTATGAAAAGAAGGGATGAGACCATGCAGCCTGCAAAACCATCTTTCCTTGAATATTTTGAACAAAAAGAAAAGGAAAACCAGATCAACAGCTTTGGCAAGAGTGTACCTGGCCCACTGAAGAGCTCTTCAGATTGGAAAGTCCCACAGGATGGAGACTATGAGTTCCTTAAGAGTTGGACAGTGGAGGACCTTCAGAAGAGGCTCCTGGCCCTCGACCCCATGATGGAGCAGGAGATCGAAGAGATCCGGCAGAAGTACCAGTCCAAGCGGCAGCCGATCCTGGATGCCATCGAGGCTAAGAAGCGGCGGCAGCAAAACTTCTGAGCCAGGCCGGGCGGGGCGCCCGCTCGCACACGGCCCCCGGGGGGCTCGGGGCCGCTCGCCGCTCAAGCTTGTTAGCCAGCACTTCTGCGCCGTGTTTCTCCACAGCACCCTCGCCAGCTCAGGAACGCGCGCCCGTGGGAAGAGCTGCCTCGACAGTCAGCGTGCCGTCGTGATGTGTGTGTCCAAACTGGTCAGGTTTATTACGTCAAAGGATTTACATTGGCTCCTTTAAACTCAGAGTTTTAAACCCCAGGAACAGAGACTCCTAGTCGAGTGATAGCTGGGAAAGTTTGACACGGTCTTTTGTTTCTCTTCTCCCGATAGCTTTCAATTGTTCTTTCTGGAAGACTTTTTAAAAATATATAAATATGCATATATATATATAAATTATAACTAGATCGCCCTGCCACTCAGTGTGGTGGCATCTCTGTACAGGTACAGTTCTAAACAGTTTGCCTCTTTTCTTTAAGACTACGGTACCACGGAACACAAAGGCAGAGGACACGGGGGCTCTGGGGTCACCCGACTCCAGGGGCCAACCTCACCCTTCTGCAGGGCTGCATTTAAAAATTACATTCAGGCCAGTTCTCACCATAGTTCCGGCCTCGCGTGGGTCATCCCCGGTTTCTGGAGCTATTGGTGACGTCCAAGGGAAAGCCTTGAGTTGTGTGTACTTCTCCAGTCCCAGGAGAAGCCCGGCGCCCTCTTTGCAAATCGGCCTTTGCGGTTTCAGCGCCTTTCATTCACCTCCACTCTCCCAACTGCCTAAAGTCACAGCACAGATACTGCCCAGTGCCTTAAGAGGCGGAGACGTGACCCAGTGAGGGGACAGGCCTGCCAGGAGCTCTCAGCTGTGTTCAGTCCACAGACGGGAAAGGGTTCTCGAAGTTCTCGCTGTTCATGTGAAGATCACACGTGTGGCATTTCGCTCCACATTCCTTACAGATGGGTGGAGGGCATTGATTTTTGTGATCCACATTCAAATATGTGACCGTTTTCTTTTTTTTATTTTACTGCTAAGGGGTCTGGAAAGGATAAGTGAATGTCAGACTCAGATTTGTTCTCCAGGAGGCTCAACCCAGACACGTGGAATGCCAGAGCTGGAAGGGACCCTAGACGTCATCTGGCCTGACTGAGGCTTGGGGAGGGCAGGTGACGCGGCCAGAATCGCAAAGCAGGTTAAAGTAGGCGCTGAGACTAGACCTCGGGGCTCCTCACTCCTGGTTCACTGAGCCAAGCAGCCCCTTCACCGAGGAAGAAACTTGTGTCCATTTTGGTTAAATTGTTCCAGGGAAGCCTGCTAACAGAAGCTTGCTCTTGCTTTGTCTCTTCAGTGGGTGACTGCCTATAAGATCATTCCATTTCAGCCATTCCTTGGCCCCTGCAGCATCTGCCAGATAGCAGCAAGCTTTATGCTGTCAGATTTAGGGCCAAAAGCAGATCAGGGGGTGTGCAAAAGACAGCACTGAGCTTTTCTGCAGTGTTGGCTCAAGGCCACATGTCAGTCAGTCACACAGCAAAGAGGAGATAGTTGGGAAAGCAAATATGTTTTTATTTTCAAGTCTCTCTTCCTCTCAGATAGGGGACTATGACTGGGTGGCACCTCAGGATACTATCATTTGACTCCATAATTGCTTTTGCTTCCGCAACCTGGGAATCAATGGAAAGGCAAGGAATGTTTCTCTTCTGTGGCTAGATTCTATTCTTTGCAATTAAAACAAATTTTTAAAAATGCAAGAGGCAGTAGTTGGTCTGTAGGCCGGTTAAGCAGCTATGTGGCAAACACAGAGAATAGAGGACAGTTTGAGGATCCCACTAGAATAATAAATGGCAGCTAGCACTCGTTGACCACTTAACGATATGCCAGGCACTGAGCTAGGTGGGTTCTTTCTGTGTGTCAGCTCTAAACTCCATAATAACTCTGTGAGTTAAGTACTCTATTTCCATTTCATAGATGAAGAAACAGGGTTGGGGGTGGGGGGGGCGCGGAGTTCCTTCCCAAGGCAGTAAAGCTAGTAAGAGGTAGAATCAGGATTCACAGCATCACCACATGGGACCAGTGTTTACAGGGGAAAGGAAAGTCACAGGTCTTTTTAAAATGAAGTGACCACCTATTTTTGCACAGACAAAGTAACTTCTAATGGGCACGAATCTTGAGCTTACTTTGTTTGAAGCATGTGTGCACCCAGCATGCTGGTCCAACAAGGTACATTGCTCTCCAGTCTAGCTAGACAGAGTTCTTTGCCAGAAATTAATTCCTTTTGGATCAGATAAATTTCCTGACAAGGCGAATTTGTTTTCTAGCGACAGGAAGACAGAGGAGCAAATCCTAGTCATTTTTTCCCATAAATATTAAATTCTAGATAGATCGGTGTGCTTTCATTTAGCCCTGAGTGACAGTCATTGCTTGAGCATTTGTGACTCAAGCTTCCAGGGAATTCTTAGCCCCTCACTTGTTCTCTCCTTCTAAGAAAGAACGACCCACATCTAATTGTATCTTTAAAAAACTTCATTTCTCTTAAGAATATCTCAGTTGCTTCCTCATCATTAATTTTGAAGCAAATTTCTATTTTTCTTTTTCCACTGTCCCTTCTCCCAACCAATTGGATTAATGGATGAACATTTGGCTGGATAGATAGATAGACAGGTAGATGATAGACAGACAGACAAATAGATGATAGATGATGATTGGTAGATGATGATTGATGATGCTGAGAGAGAGAGAGAGAGATAGGGACAGAATCAATAACTGAAGCAACTTAAGCACTATAGCCTTAACTCCTTGAGACTTTCTGATCCAGGAAACATTTATTTAGCACCTACCAGATGCCAGAAATTTATTACACCATTCAAATCTCAATAGCTCTTACCAATATCAGGAACAAGAAAGGTGACATCATTATAGGTCCTATACAGATATTAAAAGGCTAATAACAATACTATGAACAATTTTATGCAAATTCAACAATTTAAATGAAATGGACAATTTCTTGTAAAGATATAAAGTACTAAACTCAAGAAGAAATAGATAATCTGAATAGCCCTATATTTATTAAAACGTAATAGCTCTGGGAAATATTACTGTCATTTTACAGATAAGGAAACAGA