Transcript asmbl_57025

Sequence
Transcript Sequence for observation asmbl_57025 of TGE0006675:
GGGCGGTTTGAACGAGACGAAGACGAAACCGGAGCCGGGCACGGGCAGTGGACGCGGTTCCGCTGAGAGCCGAAGATGGCAGTGAACGTATATTCAACATCAGTTACCAGTGATAATCTAAGTCGACATGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATTTGACAAAGATAGAACAGTTGTGCTCAGGGGCTGCCTATTGTCAGTTTATGGACATGCTGTTCCCTGGCTCCATTGCCTTGAAGAAAGTGAAATTCCAAGCTAAGCTAGAACATGAATACATCCAGAACTTCAAAATACTACAAGCAGGTTTTAAGAGGATGGGTGTCGACAAAATAATTCCTGTGGACAAATTAGTAAAAGGAAAGTTTCAGGACAATTTTGAATTCGTTCAGTGGTTCAAGAAGTTTTTTGATGCAAACTATGATGGAAAAGACTATGACCCTGTAGCTGCCAGACAAGGTCAAGAAACTGCAGTGGCTCCCTCCCTTGTTGCTCCAGCTCTGAACAAACCGAAGAAACCTCTCAGCTCTAGCAGTGCAGCTCCACAGAGGCCCATTGCAACACACAGAACTACTGCAACCCCTAAGGCTGGCCCGGGTGTGGTGCGAAAGAATCCTGGTGTGGGCAATGGGGATGACGAAGCAGCCGAACTGATGCAACAGGTCAACGTATTGAAACTTACCGTTGAAGACTTGGAGAAAGAGAGAGACTTCTACTTTGGAAAGCTAAGGAACATTGAATTGATTTGCCAGGAGAATGAGGGGGAAAACAACCCTGTATTGCAGAGGATTGTGGACATTCTCTATGCCACAGATGAAGGCTTTGTGATACCTGACGAAGGGGGTCCACAGGAGGAACAAGAAGAGTATTAACAGCCTGGACCAGCAGAGGAACGTTGGAATTTTTCACTCCAAATCATGTGCTTAACTGTAAAATACTCCCTTTTATTATTCTTAGAAGACTCACTGGTTTCTTTTCATAAGCAAAAAGTACCTCTTCTTAAAGTGCACTTTGCAGAAGTTTCACTCCTTTTCCAATAAGTTTGAGTTAGGAGCTTTTTACCTTGTAGCAGAGCAGTATTAACATCTAGTTGGTTCACCTAGGGAACAAAGAGGCTGACCATGGGGCTCACCGAATGGATACTGGTAACACTGATTACTGGAGAAGGTGTTTTTATGTGATATGCTGAGGTGGAGACCTCAGAGAAAATGTAAAGACTGATTTGAATTTTAAGCTAATGTGAAATCTTGGCAGAGAACGTTTTAATAAATAAATGCCTTAAGAGTATTTAAAATATGCTTCCATATTTCAAAATATAAAATGTAACCTGACGGGATTTTGTGTGTTCAACCTTGTGTCTGGAAAGGAAGGGCCAGACCTTGGAACCTTTGGAACCTGCTGTTCACAGGCCTTGCAGGGCAGCTTGAATCTTCACAGGCCTAACCTTGGCCCAGAAGGGAAGTTTAAAATGTTGCTCTGTAAAGCCGTGTGGTGTCCTTGATCAATTGCATCTCTGCTAGGAAGCAAGAGGCGTTGCCTGAATGAATAAGAGTATGTTTTAGTCCTGAGATGTTTGAGTTGAATAGCTCGATTTTCATTGAGCATTTCTCTGACGATTTTTCCAATTACCCCTGAAATTTCTATGTATTGTGTTTATTTTTGGGAAATGAGGTGTGTTCAGTTTTTAAATCTAACAACTACTTTTTGGGACTTGCCCACATCTCTGGGATTTGAATGGGGGTTGTGTCCCATTTTACTGTTTTTTTAAGTTTACATTTAACATATTTCTCTTCTCTGCTCCCCTTGCCCACTGGGGACTCCTCTTTGGCTCCTTAAAGTTTGCTGCTTAGAGTGGAAGTTGAACAGGCAGGTGATCATGCTGCAAGTTCTTTCTGGACCTCTGGCAAAGGGAGTGACCAGTGAAGGCCATCGCTACCATGGGATCTGCAAGGCTGGGTGTTTTTGGTACCTGCTGTCCACAGCCTTCCACTGTTATCGGAATACTTTGCCAGTGCACTAATCTCTTTGGAGATAAAATTCGTTAGTGTGTTACTAAATGTTAATTTTCTTTTGCAGAAAATACAGTGCCATGTCTGAATTAATTATTAATATTTAAAATATTTCATTCCTTAACACTCCCTCATTTGCTTTGCCCACAGCCTATTCAGTTCCTTTGGCAGAATTCTGCAAAATGTGTGTCACCCACTACTGAGATTGTTCAGCCCCTGATGTATTTGTATTGATTTGTTTCTGGTGGTAGCTTGTCCTAAAATGTGTGTAGAAAGCCGGTATTTTATGATAAATTGTTGTGTAGTGCATGCTCTGTGTGGAATTCAGAGGAAAACCCAGATTCAGTGATTAACAATGCCAAAAATGCAAGTAACTAGCCATTGTTCAAATAACAGTGGTGCTATTTCTCTTTCGTGGCCTTTTAGACTTTTGTTGCCCTAAAATTCCATTTTATTGGGAACCATTTTCCACCTAGTCTTTCTTGACAGGGTTTTTTTCTACTTTAAACAGTTTCTAAATAAAATTCTGTATTTCAAGAGTGTCATGTCTTCTGAAATTTGTCTTGCCTTGGGTATTTTCTTTTAGGTTCAAATGATAAGGTATCGATGCTTCTTTCTTAAATTAGGACTGATCTTTTAAAAATCCTCAACTATTTTTTTTCAAATGTGTTTATTCCTAAGCCTGTTCTCTTTGTTCTGTATTTTTCATATTACATTTCTTAGCTTCCTGCTGTTTTACGTTCTTATATTACTGTAAGAGGTCTTTCAGAGGTCCAAGGCTTGACGTAGCTGCTGTGAAGCCTTTTAGCTCGTTTCCTCCTGAGATACACAGCAGGACCATGGCGAGATACTTTCTTTTGGTCTGTTTTTTTATTGAAGGTATGTTTCAAAGGCAGTGAACACCATCTT