Transcript asmbl_56854

Sequence
Transcript Sequence for observation asmbl_56854 of TGE0006647:
GGGCGCTCCGCGAGCCCGTCTCCTCGAATGAAAGGAAACAACCTCCGGCGACAGAGCCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGGTTCATGGGACAGAGTTAGAAAACTGGGAATGAATAAGACATCCATAACTACTATTCTTTTTTCACTGTTTTCTAAAATCAAAAAGGGTTTGTAACTTTTTACTGCCCAACTCTTAGATCCTTCATTGAACTGCCTAAAAACGTCTTGTTTTATGAGCCTTCTTCACTAGATGGCAGAGTTTGACATGTTGATATTACGTAGCTGTAGTTTGCAGTTTCTGGGAAGCGATTGAAACACTATTAACCCTGTGTATAGTGTCAACAGTTAAAGCAGACATTGAAATGAAGTAAGCTATATTTCTGGACCGAACAAAGTTCTGCTGTTTAGAGTGTCTAAGTTTGCTTAGTGGATTCATACTCAAAGGAAAGTATAAGCAAATTTCACTTAACAGTGCAAACATGCCTCTGGTGGCAACATGTGGGAATTTGTGGAATTTTTTTTCACACGCAAGTAATGGAGGCTAGAAATGAAGAGAACTTTATTTTTCCCTTGGCTTTGACAGCAAATGCTTAAAATCTCTTCCAAGAAGTGTGCTAAGCTTTTCATTTGGTTCCTGTTAAAGTTGTTCTCACTGACCAGCATGGACTTGGGCAACTGGTGATTATAAGCTATGAGCTCCAGTGCTTATGCCAAAATTATCTTGACAGTAAACCTCTTTTCTTTTCATGTCATACAAAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCATAGCACCTCATTTATCAAGGGTAGGGATTCTGATCATTGAATTATTAGTTAATTAAATTAAATCAGCAGGCAAATAATCATGTTAACTTGACTGCACATCAAGATATTCTACAGCTTATGGAAAAGCATTTTAAAAATGTAACAGGTGGAAAATTACACTGTGCTTAATGACTGATTTTTTTTTAACTGCTAGTCCCTTAAAGTCATATTTGTCAAGTGTGTATTCACACATTTACTTAAATCAAGGGACTCGATTGCTTTATTTTAATCATCTTTTATTATTTTTAGAAGGAAACTAGCTTTAGTAGTGAGTTGTCTTCCCTATATGTTTTTCTCTTCTTGCTCTAAATATGCCATTGGGTTTCTTTGTGTGTATGTGATGAATTTTCAAAATTCACCGTGACTTGAAGTGCAACGACAGATCTAGATGTTTGTTTACCAAGCTATGTGACTTTTCCCAAAGGATCTGTACTTTATTTCCTTACAACAGCTTGAAACCCGTTATTTTAAATCTTTGAATCACTGTGTCTAGATCATTTTTACATTGTGTGCCATTGATTTACCCGTGGAACTATAGAGCACCTTCATTTTTGGACAACTACTGTAATGATGTTTTTAGGAAAAATAGAAGGTGCCAGGGGTAATAATGGCCAGTCAATAATCACATAATGGACTTCAAATACTATAGCTGTCAGTTGATGGATTTGTTATGTAATAAAGTGTATGATTTTTGTATGGGTTTCTTCAACCCTTTCTGCCACTAGCAACCAGAATAGCACTTTTACCTTTTGGTTGGCTAGGTAAGTGGCTGGCTACCTATTTTTCTCACTGTGGTGTGATTGGCTAAATAGTCTTTCATTAAAAATTAAAATGTAAATTGAAGTCACACGAAAAATCATGTTTGGTTGTAAACCGCCGATATTTTGTTTTTCTATCTATGTTTTCGTCACATGCTGAGTAAAAGTGCCTTACAATGTAAAAATTGTACAGTACTTATGTTCTCAAGTAGCATCATCATCTTCTGGGTAGTAATTACATTGTGGTATGAATATTTAGAAAAATGGACCTCAGCAGTGTATTTACTGTTCATCTCTTAAGTCCTTAACTGTAGTTTTAATAAGCATGACATTATTTGATAAGTATATAACATTTACATCATTTCAAAAAATACTGCCATGACTGTCTTTTATGCATATTTTAGCTTGAAATTTTGAAGCATCTTTACTGTTTTCCTTTTTTCTTTTTTCCTTTTTTCT