Transcript asmbl_56851

Sequence
Transcript Sequence for observation asmbl_56851 of TGE0006647:
GGGCGCTCCGCGAGCCCGTCTCCTCGAATGAAAGGAAACAACCTCCGGCGACAGAGCCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCATAGCACCTCATTTATCAAGGGTAGGGATTCTGATCATTGAATTATTAGTTAATTAAATTAAATCAGCAGGCAAATAATCATGTTAACTTGACTGCACATCAAGATATTCTACAGCTTATGGAAAAGCATTTTAAAAATGTAACAGGTGGAAAATTACACTGTGCTTAATGACTGATTTTTTTTTAACTGCTAGTCCCTTAAAGTCATATTTGTCAAGTGTGTATTCACACATTTACTTAAATCAAGGGACTCGATTGCTTTATTTTAATCATCTTTTATTATTTTTAGAAGGAAACTAGCTTTAGTAGTGAGTTGTCTTCCCTATATGTTTTTCTCTTCTTGCTCTAAATATGCCATTGGGTTTCTTTGTGTGTATGTGATGAATTTTCAAAATTCACCGTGACTTGAAGTGCAACGACAGATCTAGATGTTTGTTTACCAAGCTATGTGACTTTTCCCAAAGGATCTGTACTTTATTTCCTTACAACAGCTTGAAACCCGTTATTTTAAATCTTTGAATCACTGTGTCTAGATCATTTTTACATTGTGTGCCATTGATTTACCCGTGGAACTATAGAGCACCTTCATTTTTGGACAACTACTGTAATGATGTTTTTAGGAAAAATAGAAGGTGCCAGGGGTAATAATGGCCAGTCAATAATCACATAATGGACTTCAAATACTATAGCTGTCAGTTGATGGATTTGTTATGTAATAAAGTGTATGATTTTTGTATGGGTTTCTTCAACCCTTTCTGCCACTAGCAACCAGAATAGCACTTTTACCTTTTGGTTGGCTAGGTAAGTGGCTGGCTACCTATTTTTCTCACTGTGGTGTGATTGGCTAAATAGTCTTTCATTAAAAATTAAAATGTAAATTGAAGTCACACGAAAAATCATGTTTGGTTGTAAACCGCCGATATTTTGTTTTTCTATCTATGTTTTCGTCACATGCTGAGTAAAAGTGCCTTACAATGTAAAAATTGTACAGTACTTATGTTCTCAAGTAGCATCATCATCTTCTGGGTAGTAATTACATTGTGGTATGAATATTTAGAAAAATGGACCTCAGCAGTGTATTTACTGTTCATCTCTTAAGTCCTTAACTGTAGTTTTAATAAGCATGACATTATTTGATAAGTATATAACATTTACATCATTTCAAAAAATACTGCCATGACTGTCTTTTATGCATATTTTAGCTTGAAATTTTGAAGCATCTTTACTGTTTTCCTTTTTTCTTTTTTCCTTTTTTCT