Transcript asmbl_26930

Sequence
Transcript Sequence for observation asmbl_26930 of TGE0004556:
GGAAGATGTTGGCTATTTGGCGATAGAAGTGGTGAAAACTGACCTCACACCGGTAGACGAGCACTACGGGACCTGATCCTCTTGCTGCACGGGCAGCCGGCCCCCACTGAGCATGTTGGGAAGCCATGGAGTCCACTGGAAAACACTAGTCTGATCTTGGAAGTGGCTGATTGTGGCAGGATGTGTCGACGATGATGATGGCCAGAAAGCAAGATGTCCGTGTTCCCACCTACAACATCAGCGTGGTGGGGCTGTCTGGGACCGAGAAGGAGAAGGGCCAGTGCGGCATCGGGAAGTCCTGTCTGTGCAACCGCTTCGTGCGCCCGAGCGCCGACGAGTTCCACTTGGACCACACCTCTGTCCTCAGCACCAGTGACTTTGGCGGGCGGGTGGTCAATAATGACCACTTCCTCTACTGGGGAGAAGTCAGCCGATCCCTGGAGGATTGCGTGGAATGTAAGATGCACATCGTGGAGCAGACTGAGTTCATTGACGATCAGACCTTTCAGCCGCATCGAAGCACGGCCCTGCAGCCCTACATCAAGAGAGCTGCCGCGACCAAGCTCGCGTCGGCTGAGAAACTCATGTACTTTTGCACTGACCAGCTGGGGCTGGAGCAGGACTTTGAGCAGAAACAAATGCCAGATGGAAAGCTGCTGATCGATGGTTTTCTTCTCGGCATTGACGTTAGCAGGGGCATGAATAGGAACTTTGATGACCAGCTCAAGTTTGTCTCAAATCTCTACAATCAGCTTGCAAAAACAAAAAAGCCCATCGTGGTGGTCCTGACTAAGTGTGATGAGGGCGTCGAGCGGTACATTAGAGATGCACATACTTTTGCCTTAAGCAAAAAGAACCTCCAGGTTGTGGAGACCTCAGCAAGATCCAACGTCAACGTGGACTTGGCTTTCAGCACCTTAGTGCAACTCATTGATAAAAGTCGGGGAAAGACGAAAATCATCCCTTACTTTGAAGCTCTCAAGCAGCAGAGTCAGCAGATAGCTACGGCAAAAGACAAGTACGAGTGGCTGGTGAGTCGCATTGTGAAAAACCACAACGAGAACTGGCTGAGTGTCAGCCGAAAGATGCAGGCCTCCCCTGAGTACCAGGACTACGTCTACCTGGAAGGGACCCAGAAAGCCAAGAAGCTGTTTCTCCAGCACATCCACCGCCTCAAACACGAGCACATCGAGCGCAGGAGGAAGCTGTACCTGGCAGCTCTGCCGTTGGCTTTCGAAGCTCTTATACCCAATCTGGATGAAATAGACCACCTGAGCTGCGGAAAAGCCAAAAAGCTCTTGGAGACCAAGCCGGAGTTCCTGAAGTGGTTCGTCGTGCTCGAGGAGACCCCGTGGGATGCCACCAGCCACATCGACAACATGGACAACGAGCGGATTCCCTTCGACTTGATGGACACTGTCCCCGCAGAGCAGCTGTATGAGGCCCACTTAGAGAAGCTGCGGAACGAGAGGAAAAGAGCTGAGATGAGGAGGGCGTTTAAAGAAAACCTGGAGACCTCGCCTTTCATAACTCCTGGCAAGCCCTGGGAAGAGGCCCGCAGTTTCATCATGAATGAAGATTTCTACCAGTGGCTGGAAGAATCTGTATACATGGATATCTATGGCAAACACCAAAAGCAAATTATAGACAGGGCAAAGGAGGAGTTTCAGGAGCTGCTTTTGGAATATTCAGAATTGTTCTATGAGCTGGAGCTGGACGCTAAGCCCAGCAAGGAGAAGATGGGTGTTATTCAGGATGTCCTGGGGGAAGAACAGCGGTTTAAAGCGCTGCAGAAGCTCCAGGCGGAGCGCGATGCCCTCATCCTGAAGCACATCCACTTCGTGTACCACCCAACAAAGGAGACGTGCCCCAGCTGCCCAGCCTGCGTGGACGCTAAGATCGAGCACTTGGTTAGTTCCCGGTTTATCCGACCATCTGACCGGAATCAGAAAAATTCACTCTCTGACCCCAACATCGATAGAATCAACTTGGTTATCCTGGGCAAAGATGGCCTTGCCCGAGAGTTGGCCAATGAGATTCGAGCTCTTTGTACAAACGATGACAAGTACGTGATAGATGGTAAAATGTATGAGCTTTCCCTGAGGCCGATAGAAGGGAACGTCAGGCTTCCCGTGAACTCTTTCCAGACGCCCACGTTTCAGCCCCACGGATGTCTCTGCCTCTACAATTCGAAGGAGTCGCTGTCCTACGTGGTGGAGAGCATCGAGAAGAGTAGAGAGTCCACACTCGGCAGGCGAGATAATCACTTAGTCCATCTCCCCCTGACGCTAATTCTGGTGAACAAGAGAGGAGACACCAGCGGAGAGACGCTGCATAGCTTAATCCAGCAAGGCCAGCAGATCGCCAGCAAACTCCAGTGTGTCTTCCTGGACCCTGCCTCTGCCGGCATCGGTTATGGACGCAACATTAACGAAAAGCAGATCAGTCAAGTGTTGAAAGGACTCCTGGACTCTAAGCGTAACTTAAACCTGGTCAGTTCTACCGCTAGCATCAAAGATCTGGCTGACGTTGACCTGCGAATTGTCATGTGTCTGATGTGCGGAGACCCTTTTAGTGCAGACGACATCCTCTTTCCCGTCCTTCAGTCCCAAACCTGTAAATCTTCCCATTGCGGAAGCAACAACTCTGTTTTACTTGAACTACCAATCGGGCTACACAAGAAGCGCATTGAACTGTCTATTCTTTCATACCATTCCTCGTTTAGCATCAGAAAAAGCCGGTTGGTCCATGGGTACATTGTTTTTTATTCAGCCAAACGTAAGGCCTCCTTGGCTATGTTACGTGCCTTTCTTTGTGAAGTGCAGGATATTGTCCCCATTCAGCTGGTCGCACTCACTGACGGCGCTGTAGATGTCCTGGACAATGACTTAAGTCGGGAGCAGCTGACCGAGGGGGAGGAGATCGCTCAAGAGATAGATGGCAGGTTCACAAGCATCCCCTGCAGCCAAGCCCAGCACAAACTCGAGATCTTCCACCCATTTTTTAAGGATGTGGTGGAGAAAAAGAACATAATCGAGGCGACGCACATGTACGATAACGCTGCCGAGGCCTGCAGCACCACGGAGGAGGTGTTCAACTCCCCCCGGGCGGGCTCTCCGCTCTGCAACTCCAACCTGCAGGATTCGGAAGAGGACATCGAGCCCCCTTCCTACAGCCTGTTTCGAGAAGACACGTCGCTGCCCTCTCTGTCCAAAGACCATTCCAAGCTGTGTATGGAGCTGGAGGGGAACGATGGGCTGTCTTTCATCATGAGCAATTTTGAGAGTAAACTCAACAACAAAGTACCTCCGCCAGTCAAACCAAAGCCTCCTCTCCATTTTGATATTACAAAGGGGGATCTGTCTTACTTAGATCAAGGCCACAGAGATGGGCAGAGGAAGTCTGTGTCTTCTAGTACCTGGCTACCTCCGGACGCGTTCGATCCTTCCGATTACGCCGAACCCATGGATGCAGTGGCCAAGCCGAGAAATGAGGAAGAAAACATATACTCGGTGCCCCACGACAGCACCCAAGGCAAGATCATCACCATCCGGAACATCAACAAAGCCCAGTCCAACGGCAGTGGGAACGGTTCCGACAGTGAGATGGACACCAGCTCCCTAGAGCGAGGCCGCAAGGTATCCATCGTGAGCAAGCCAGTGCTGTACAGGACGAGATGCAGCCGGCTGGGGAGGTTCGCTAGCTACCGAACCAGCTTCAGCGTGGGGAGCGATGATGAGCTGGGGCCCATCCGGAAGAAAGAGGAGGATCAGGCGTCCCAAGGTTATAAAGGGGACAATGCCGTCATCCCGTATGAGACAGACGAAGACCCGAGGAGGAGGAACATCCTGCGCAGTCTGCGAAGGAACACCAAGAAACCAAAGCCCAAACCCCGGCCGTCCATCACGAAGGCAACCTGGGAGAGTAACTATTTTGGGGTCCCCTTAACGACCGTCGTGACTCCAGAGAAGCCAATCCCTATTTTTATTGAGAGGTGTATTGAGTACATTGAAGCCACAGGACTGAGCACCGAAGGCATCTACCGCGTCAGCGGGAACAAGTCGGAGATGGAGAGCCTGCAGAGGCAGTTCGATCAAGACCACAACCTGGACCTGGCGGAGAAGGACTTCACAGTGAACACGGTGGCTGGGGCCATGAAGAGCTTTTTCTCGGAACTGCCTGACCCCCTGGTCCCGTACAGCATGCAGACTGACCTGGTGGAGGCTCACAAAATCAACGACCGAGAGCAGAAGTTGCACGCCCTTAAGGAAGTACTCAAGAAATTTCCGAAGGAAAACCACGAAGTCTTCAAATATGTCATCTCGCACCTGAACAAAGTCAGCCACAACAACAAGGTGAACCTCATGACCAGTGAGAACCTCTCCATCTGCTTCTGGCCCACCCTGATGCGGCCGGACTTCAGCACCATGGACGCGCTCACGGCCACGCGCACCTACCAGACGATCATTGAGCTCTTCATCCAGCAGTGCCCCTTCTTCTTCTACAACCGGCCCATCAGCGAGCCCCCCGGCGCCACGCCCAGCTCCCCCTCCGCCCTGGCCTCCAGCGTGCCCTTCCTCACCTCCACACCGGTCACCGGTCAGCCGTCGCCCCCACAGTCGCCTCCACCCACCCCTCAGTCCCCGATGCAGCCCCTGCTCCCCTCCCAGCTTCAAGCCGAGCACACGCTGTGAGTCACCAAGGCCTGGGGCAAAAAGAGGCTCGATTTTCTCAGTCGGGGTGGCGTTTGGTCTTGAACACAACCAGGTCCACTGGGGCAGGGGTGGGGAGGCTGTCCCCTCCCCCTCTGTCACCTTCTCAAGATCTCAGCTGCAGCACCAGCCAGCGTCCACCATAGGCTGGGCCCGCGGCGCCCCGAGCCCAGCGCCGCAGACCTGGGGCTGACTGCGGGCAGCGGCTGGGGGCCCTGCCCTTGGACACGGACCCCTTCGAAGACTGACTGGCCAGGCGGCGGCCCCGGTGGCCGTCCACATGCTCGCTGTTCCGGGACTGCCTGCCCACGCACACCAGCTTCGGCGTCACCCACTGCCTGACAGAGCCCTGGCCTTTGCCAGGGGGAGGAGGTGGTTTTGATTCGGGCCACCCCTGGCAACCTCCGAGGAGACACTTCTCATCTGGCTCACCTGTCTCCCTACCTTCCACATCTGTTCCCACCCCCGTCGGCGGGGCGCCTGTCCAGCAGCCTCCTGGGGAACAGAGGCCACGGCGCTGCCGCCCCAAGGCACAGTGCCGAGGGCGTCTGCCCGGCCGCCCAGAACAGCTGGAGGGAGCTTTGTGCCTGGACCGAGAGAGTGTGACTCGTCCCTCCAGCCCCCGTGCTCCCTGTCCGCTGCATAGGCTTCGGGGACAGTTCCCTTCATGACAGAGGGACACTGGGAGAAAAGGAGGAAAACCTGTCCAGTAACTTGGAAAAACAAAAAGGAAGAAACTACAGACCTCAAGACTCAGCTCCCCCGCTTCTCAGGCCGACGGGCGCAAGGGGGCCCTGGTCTTTGTGACAGCAAAACCAGGAGGCCTGGCGGGCGGCTGCCTGAGAACTAGTTGGGGGTCCCACTCACGTCCTGTTATCAGGTCTGTGTTCCCCAAGAAGAGACGATTCGAGCCCTCGGTGGGTGGAGCTGGGGATTCGAGCAGACCAGCCTGGCACCTGGTCTGCCCTGGAACACTACAGGCTGTGGGGACACTGGGGGGAGGAGGACTGGAGTGGGGCCAGCTCAGGGCGCACTGGGGTTTCGTTTAG