Transcript asmbl_55609

Sequence
Transcript Sequence for observation asmbl_55609 of TGE0001320:
CCTCCTCCTCCTCCTCCTCCTCGCGTTAGTTCCGGTCGCAGAGGAGAGACCGCCGCAGTTGTCGCCACATCGCGGATTTCTGGCTCTTTTCTCTTCGCCTTAAATTCGGGTGTCTTTTATGAATAATCAAAAGCAGCAAAAGCCAACGCTATCAGGCCAGCGTTTTAAAACCAGAAAAAGAGATGAAAAAGAGAGGTTTGACCCTACTCAGTTTCAAGACTGTATTATTCAAGGCTTAACTGAAACTGGTACTGATTTGGAAGCAGTAGCAAAGTTTCTCGATGCTTCTGGGGCAAAACTTGATTACCGCCGATATGCAGAAACACTCTTTGACATTCTGGTGGCCGGCGGAATGTTGGCCCCAGGTGGTACACTGGCAGATGACATGATGCGTACAGATGTCTGTGTATTCGCAGCACAAGAAGACCTAGAGACCATGCAAGCATTTGCTCAGGTTTTTAACAAGTTAATCAGGCGTTATAAATACCTGGAGAAAGGTTTTGAAGATGAAGTGAAAAAGCTGTTGCTGTTTCTAAAGGGTTTTTCGGAGTCAGAGAGGAACAAGCTGGCTATGTTGACTGGTGTTCTTCTGGCTAATGGAACACTTAATGCGTCCATTCTTAATAGCCTTTACAATGAGAATTTGGTGAAAGAAGGAGTTTCAGCAGCTTTTGCTGTAAAGCTCTTTAAATCATGGATAAATGAAAAAGATATCAATGCAGTAGCTGCAAGTCTTCGGAAAGTCAGCATGGATAACAGATTAATGGAACTTTTTCCTGCCAATAAACAAAGCGTTGAACACTTCACAAAGTATTTTACTGAGGCAGGCTTGAAAGAGCTTTCAGAATATGTTCGGAATCAACAAACCATAGGAGCTCGTAAAGAACTCCAGAAAGAACTTCAAGAACAGATGTCCCGTGGTGATCCATTTAAGGATATAATTTTGTATGTCAAGGAGGAGATGAAAAAAAACAACATCCCAGAACCCGTTGTCATTGGAATAGTTTGGTCCAGTGTAATGAGCACGGTAGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATCAAGCACTTGAAGCAATACAGCCCTCTACTTGCTGCCTTTACTACTCAAGGTCAGTCTGAACTGACTCTGTTACTGAAGATTCAGGAGTATTGCTATGATAACATTCATTTCATGAAAGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGCTGAAGTCCTGAGTGAAGAACCCATTCTGAAGTGGTATAAAGATGCACATGTTGCAAAGGGGAAAAGTGTCTTCCTTGAGCAAATGAAAAAGTTTGTTGAGTGGCTCAAAAATGCTGAAGAAGAATCTGAGTCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCCTCAGTAAAGCAAACAGGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATCTTCCTACCTCCCTATATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTACTGGATATGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTTTTTTCAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTTTCCCTGGGTTTTCTATATAAACAGTTTTCAAGATATGATTTGGTTAAAAATAATTTGTTATAAGAATTTTGTTTGCAAATTAAACTGTAAAAGTATCCAAAGTCTCAAAAGGCAATGATTTGTGTGATAATTTGGTATGCCCAAAGCCCTCCTCATCAATGACAGTCTCATACAGTGATTGAATTCATTAACATGAATCTTGAGTATTTGAACCATTGCTTACATATTAATATTTTCTTGCATTTTTAACCCCAGATGTCCTCGAGTTCAGTTGTTTGCTCTCTGGTTTTCATTCCTTGGTAAAGCCATGGAGAACAATCTTGAAAGTGAGGTCTCTGGGAAATTGTATGTGGCAGATGTGATAGGAAGAAGAAAGTTGAGCTTTTTCCCATTGAGAAACTTCTGCATTCAGTTTGTGTCTTTCCAGGAAAAGCAAATGGGTATTTTTTTCATACCGTTTTCAACTGTACCTTAAAAAGTTTTGTCATTTAACGAATTTAACACTTGTCATATGTTTAGATAGGAAAGGACTCATGAAATAGTGAATAAAGAAAATGACTGTTGAAATGTTAAGTGATCAGCATGGTCTAATTGGGAACTCTTAAATATAACTCATTTCCTGTGGGTTAAGCGTATTTGATGTAAAGAATGGAGTGTAATAATGATATATTCCCACTTGGTCATATAAGACCAGCTTCATTCTTGTAACATTAACAAATGATTCAAGCATCTGACTATTAACATGCCCTAGTT