Transcript asmbl_55563

Sequence
Transcript Sequence for observation asmbl_55563 of TGE0030928:
GTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCA