Transcript asmbl_55359

Sequence
Transcript Sequence for observation asmbl_55359 of TGE0006524:
GGATTGGAAGGCCGAGCGTATAAAGCCGCGCAGAGAGCGTGAAACAAAGCAGTCGGATCGGAATTGGACTTGGGGTGCGCCGTGTGGAGTCAGGCATAAAACTTGTTGGAGGGGAGTAACGAGCCTGCTCCTCCAGCTCTCCTCATCTGTGCGGGTTCCCACCAGCCTTGCGATTTATTTTTATATCTGCTTTTTTTATATATAGAGAAATATATATACATATATATTTTTTTCCCCATAAGAGAAAATTTCTGTTCCAAGAGAAAATAAGGCAAGATCAATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGTAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGAGACAGTCAGTGTGGGAAAACCGCGCTGCTGCATGTCTTCGCCAAAGACTGCTTCCCCGAGAATTACGTCCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTATTATGACAACGTCCGGCCCCTCTCTTACCCAGATTCTGATGCCGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACTCTAGACAGTGTCCTAAAAAAGTGGAAAGGTGAGATCCAGGAGTTTTGCCCCAACACCAAAATGCTCATGGTTGGCTGCAAATCTGACCTTCGGACAGATGTTAGTACATTAGTAGAACTCTCAAATCACAGACAGACACCAGTGTCTTATGATCAGGGGGCAAACATGGCCAAACAGATTGGAGCTGCCACTTATATTGAATGCTCAGCATTACAGTCGGAAAATAGCGTCAGAGACATTTTTCATGTTGCCACTTTGGCATGTGTAAACAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGGGCCACAAAGCGGATTTCACATATGCCCAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGTTGCACCGTGATGTGAATCTCCCGTTATCTTTAATGAGGACAAGGAAATCTAGTGTAAAAAAACACCACAACAAAACAAAAAGGTGAAGTCTGAATGAAGTGCACAGCCAAAGTCACATATTCTGGAGGCTTAGGAGGCATTTGAAAGGATGCTCATCTTTTTGGAATCCTGTCCTTAGGTTCGGCATGTAGAACAAGTGGTGAAAAGTGAATACATTGAAGTGTTCTGAAGTGTGACTTGAAAAATATGCCAAAAAAGAGAGATTCAGATGGTCTAGAGGTAGATGAGGAGGAATGCGAGTACCTCCAAGAAGAAAAATCCCGCTCTGAATGGTGCTTGTGTTATCGTTTTCTTTGTTGTAATCTATTCATGAATCTCTACTTTGATTTAATTTTTAAATGTTTTAATCTCCTTTACAAAAAGTATATATTAATATACCGTCCTCATTGGGGAACTGGCACTGTGACCTTAGCATTTAGTTTTCTAGAGGATGTGATCTAATTTCCTCCTAGCTCATCATTAAAATGGAAATTATATCAGGACCCATGGGATATCCAGAGGAAAAGTTTGTGAGGCTTTGAAATCTTGCCTTCCTGAAGAGAGCTGAGCGAGATGGTTCTAAAGAAAGGCTTTTGCGGTCTTGCAAGATATGCAGACGGGCACTACAAAGATCGAATAGATTGAATAGAAAAATGGTGTCGATTTTTATTCAGTCTGATGGTTCTGTTCATCATTGTGATTGTCATTAAAAAGTGGTAAATTGCTCAATGTAATATTTTTGTGCGCTGTTTAGAAAAGAGGGTTGTGATTTTTTTGCCATCGTTGATGAAAATGCAAAGTCAAATAAAAGGTGTCTTGGTTTGGTGTCATAGAATGATCCAAGGGGAAAAAAATGTAGGTACTATTTTCACCTGAAGAGATAAGGAATGAAGGAATAGTAGCAGAAAGCACAGTTTGTGAGTAAGCGGTCTGGAATTAACTTACCAAAAGTACAAAGCAAAAGGCCTATTGTTTGGGAGGTGAAGCTCTAAAGCTGGCAGCATCTGATGATCTGTTGGTTTATTTCGTTTTACTTAAATGAACATGACAAGAGAGGGATCCTCTTGTCCAAGCCTTAGAGAATTTTTAGAGAGAAATTATGTAATGTCCATTCTGACACTATGCTAGCCGTTTCTAAAGAGTGATTGCTAAACCTCACTTAACCAGATTCTGCCAAGGCCCGTGTTCAATACTTGATTGCAGTTACATAAAATAATCAACATTTAAAATAGTTTACAGATATTTTTCGACCAGTTCCTTTTAGAGTTTCTTTCAGAGAAGAAACCAGATCTGACCTGTTTATTGTTGGCGCTTGTTGAAAACGAGCTTTCTTTCCAATGATAAAGCTTCATTTTTGAAGTGTTGAAGCTGTGCTCCCATTAAATTGTGGCAGGAGAGGAGATTAAGATAATTACAACACTTAGTTCTATGTCTTACAAGCACTTTGTTTTGTCTCTGCAAGAAAATACCATTCCAGCCATTTCTCATGAAATAACAGACGTTTTACCAACATAATATGCTTTGACTGATGCAGCATTATGCTTTGGGCAGTATTACAAAATAGCTGGCAAGTGCTTTCTGTATTTAAATATTGTAAAAAGAAAATAAGTTATAACTGTTATAAAGCAGAACTTTCGTTGCATTTTTTAAAATGTTGAAGTCAGTTTGTATGTTTGGTCAATGTTTCCGCAGTATTTATTAAAACATACTTTTTTTT