Transcript asmbl_55358

Sequence
Transcript Sequence for observation asmbl_55358 of TGE0006559:
GGAAAACCCTGCCCTGCGAGTGTGGGTCAATGCGTTTTTGCGGAGGAGGTGTTGGACTGCTAGGGCCCCGCTGAGATTGTCAGTTTGCGCGCTTTTGAGTTTAAGCGTGTGTGGCTGTGGCGACCCCCAGCGCGTCGCCAGCGTACCTTCCTCTGCAGGAGATAAACTGCACTCAGCTGAGTGCAAGATTAAGAGGAATTGATTAGAAGTTGACTCTAAAGGTTTATTGCAGTCAAAATGTCTCAAAAAATCCGTGGTGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAGTTGATTAAAGAAAAACTCATTTTTCCATATGTGGAATTGGACCTGCACAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAATGACCAGGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGTACAATGTTGGTGTCAAGTGTGCTACCATCACCCCCGATGAGAAGAGGGTTGAGGAGTTCAAGCTGAAACAAATGTGGAAGTCACCAAATGGCACCATTCGAAATATTCTGGGTGGCACTGTCTTCAGGGAAGCTATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCCATCATCATAGGTCGTCACGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGTCCTGGAAAAGTAGAGATAACCTACACACCAAGCGATGGATCCCAAAAAAAGACGTACCTGGTTCATAACTTTGAAGAGGGTGGTGGTGTTGCCATGGGGATGTACAATCAAGATAAGTCAATCGAAGAATTTGCACACAGTTCTTTCCAGATGGCTCTGTCTAAGAGTTGGCCTTTATATCTGAGCACCAAGAACACTATTCTGAAGAAATATGATGGACGTTTTAAAGACATCTTTCAGAAGATATATGACAAACAGTACAAATCCCAATTTGAAGCCCAGAAGATCTGGTATGAGCATAGGCTCATCGATGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGTTTTATTTGGGCCTGCAAAAACTATGATGGTGATGTGCAGTCAGACTCCGTGGCCCAAGGTTATGGCTCTCTTGGCATGATGACCAGCGTGCTGATTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCATGGGACTGTAACACGCCACTACCGCATGTACCAGAAGGGACAAGAGACATCCACCAATCCTATTGCCTCCATTTTTGCATGGACCAGAGGGTTAGCCCATAGAGCTAAGCTTGATAACAATAAGGAGCTTGGCTTTTTTGCAAAGGCTTTGGAGGAAGTCTGTATTGAGACCATCGAGGCTGGCTTCATGACCAAGGATTTGGCTGCTTGTATTAAAGGTTTACCCAATGTGAAACGTTCAGACTACTTGAATACATTTGAGTTCATGGACAAACTCGGAGAAAACTTGAAGACAAAACTAGCTCAGGCTAAACTTTAAGGTCATTCCTTGACTTGGGAGGACACGTGTTTTTTTGGTAATTAGGTCCACTGGTTTACATTTTTCTGTATAACACTCAAGAGTATGGGCAAAATCAATTTTCTAATTTGTTTAGAAGTCAGAGTTTATCTTTTCTATAAGATTACAGTCTTTTTCTTATACATACAATTATGCCACCTTCATGAATGTGGCTGGGAACTTTTTAAAATTTTATTTTCTATTAGTAGCTTAGGAATTACTTTAGTGCTGATTTGTACTCACTGTCACTTTTTCTCATGTTCCAGTATAAATGACCAAAATGAAGAGTGCTCGAAAGGGTAAACTATAGCCATGGTATTAGTCCCTAAAATTGTATAAAGTAGAAATTCGCTCCCTTCCCCACTTTTCCATGGCCTGGGGCTCTGGGTGGTTTTGCTGTAACAGGTGTCCCATCCTGTGTGGTAGAGCTGTACCTTAAAAGTTGCCCATGAGTTGGAATGAAGAGCATGGTTATAACTAAGACACAGCAGTCATATATGTAAAGAGCTCTGATTGAACGTTTCGAAAAGGCTAAAGATTTTTGAAGCCACTAAGAGTGTTTGGAATCTAGAATAAATACTACTCGGGGGTTTGTCCTCTGCGTTTGTCTCCTCCTCCTGGCCCTGTGTGGCTTAAGTATTATACTGCCCTGAACAGCATATTTCATCTAAGTGCAATAATACAAGCTGCACCTTTTTTGTACTTCTGCTGGCCTGTTGGGTTTTTTTTTTATATAAATGTGACTTTTTAGAAATTTGTTTTAAACACTATACTAGTCTGTTCTTCATCTAAACTATTAATTAAAGTTAAGTGCTAAT