Transcript asmbl_26564

Sequence
Transcript Sequence for observation asmbl_26564 of TGE0001056:
GTGAGCAGAAGGAAGCGGAAGTCCCGCCTCTCGCGCTCTCTCTTCAGAGGCAGAAGCAACGCGGAGGGAACGCGAGCATTTCGAGAACGCAGCCGCTACCACCATGAGCCTCCTCAACAAGCCCAAGAGTGAGATGACCCCGGAGGAGCTGCAGAAGCGGGAAGAGGAGGAGTTTAACACGGGTCCACTCTCTGTGCTCACGCAGTCGGTCAAGAACAACACCCAGGTGCTCATCAACTGTCGCAACAACAAGAAACTCCTGGGCCGTGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAGAATGTGAAGGAGATGTGGACCGAGGTCCCCAAGAGTGGCAAGGGCAAGAAGAAGTCCAAGCCCGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTCCTGCGGAACCCGCTCATCGCCGGCAAGTAGGGGCGTCCTCCCTGCGGCGGAGCGCGGCCCCGAGCTGTGGGGGCCTTGCCTGTGAGATGGGAATAAAAGTCCTGTGTATTTTCTAGGG