Transcript asmbl_17807

Sequence
Transcript Sequence for observation asmbl_17807 of TGE0000462:
AGGAGGCCGAGTGTTTCCTGGCGCATTCCCGGCCAGCCCGAGTGACTCACTCGGCCAAGGAAACTCCCAGGGCCCGCCCAGGACCCCCAAGCCGCCGCGGACGCAGCCCAGGATGGCGGCCCAGGTGACTCTGGAGGACGCGCTGTCCAACGTGGACCTCCTGGAGGAGCTGCCCCTGCCCGACCAGCAGCCCTGCATCGAGCCCCCGCCATCCTCGCTGCTCTACCAGCCAAATTTCAACACTAACTTTGAAGACAGAAATGCATTTGTTACTGGCATCGCAAGATACATTGAACAAGCCACCGTCCACTCTAGCATGAACGAGATGCTGGAGGAGGGCCAAGAATATGCTGTCATGCTGTACACCTGGAGGAGCTGCTCCCGGGCCATCCCACAGGTGAAATGTAACGAGCAGCCTAACAGAGTGGAAATCTACGAGAAAACCGTGGAGGTTCTGGAGCCTGAGGTCACAAAACTGATGAATTTCATGTACTTCCAGAGAAATGCCATTGAGCGTTTCTGCGGGGAAGTGAGGCGCCTGTGCCATGCCGAGAGGAGGAAGGACTTCGTGTCAGAAGCCTACCTGATCACACTGGGCAAATTCATCAACATGTTCGCTGTGCTGGACGAGCTGAAGAACATGAAGTGCAGTGTGAAGAACGACCACTCAGCGTACAAGAGGGCCGCTCAGTTTTTACGTAAAATGGCAGATCCACAGTCCATCCAGGAATCGCAGAATCTGTCCATGTTCCTGGCCAATCATAACAAGATCACACAGTCTCTGCAGCAGCAGCTCGAAGTGATTTCTGGCTACGAAGAGCTCCTGGCAGATATTGTGAATCTGTGTGTGGATTACTACGAGAACAGGATGTATTTGACGCCCAGTGAGAAACACATGCTTCTCAAAGTCATGGGATTTGGTCTGTACCTGATGGATGGGAGTGTCAGTAACATCTATAAGTTGGATGCCAAGAAAAGAATAAACTTATCCAAAATCGACAAGTACTTCAAGCAACTCCAGGTGGTTCCGCTATTTGGGGACATGCAAATAGAACTGGCAAGATATATCAAGACCAGCGCCCACTACGAGGAAAATAAATCTCGATGGACGTGCACATCCTCCGGCAGCAGCCCTCAGTACAACATCTGCGAGCAGATGATCCAGATCCGCGAGGACCACATGCGCTTCATTTCGGAGCTGGCGCGCTACAGCAACAGCGAGGTGGTCACGGGCTCGGGCCGCCAGGAGGCCCAGAAGACGGACGCGGAGTACCGCAAGCTCTTCGACCTGGCGCTGCAGGGCCTGCAGCTGTTGTCGCAGTGGAGCGCGCACGTGATGGAAGTGTATTCCTGGAAGCTTGTGCACCCCACCGACAAGTACTCCAACAAGGACTGCCCCGACAGCGCTGAAGAGTACGAGCGTGCCACGCGCTACAACTACACCAGCGAGGAGAAGTTTGCCCTAGTGGAGGTGATCGCCATGATCAAAGGCCTGCAGGTGCTGATGGGCAGGATGGAGAGCGTGTTCAACCACGCCATCCGGCACACCGTCTATGCCGCACTGCAGGACTTCTCCCAGGTGACCCTTAGGGAGCCGCTGCGGCAGGCCATCAAGAAGAAGAAGAACGTCATCCAGAGTGTCCTGCAGGCCATCAGGAAGACCGTGTGTGACTGGGAGACGGGGCATGAGCCCTTCAATGACCCAGCCTTGCGGGGCGAGAAGGACCCCAAGAGCGGCTTCGACATAAAAGTACCACGCCGCGCCGTGGGACCCTCCAGCACTCAGCTTTACATGGTGAGAACCATGCTAGAGTCCCTCATTGCAGACAAAAGTGGTTCCAAGAAAACCTTGAGAAGTAGCCTTGAGGGGCCCACCATATTGGACATAGAAAAATTTCATCGAGAGTCATTCTTCTACACTCACTTGATAAATTTCAGTGAAACGCTGCAGCAGTGCTGTGACCTTTCGCAGCTGTGGTTCCGAGAGTTCTTCCTGGAGCTGACCATGGGCAGGAGGATCCAGTTCCCCATTGAGATGTCGATGCCCTGGATCCTGACGGACCACATCCTGGAGACCAAGGAGGCATCGATGATGGAGTACGTGCTCTACTCCCTGGACCTGTACAATGACAGCGCCCACTACGCGCTCACCAGGTTCAACAAGCAGTTCCTGTACGACGAAATTGAGGCCGAGGTGAATCTATGTTTTGACCAATTTGTTTACAAGCTAGCAGACCAGATATTTGCCTATTATAAGGTTATGGCAGGAAGTTTGCTTCTTGATAAACGGTTACGATCAGAATGCAAGAATCAGGGAGCCACGATCCACCTCCCGCCGTCTAACCGCTACGAGACGCTGCTGAAGCAGAGGCATGTGCAGCTCCTCGGCAGATCAATAGACCTCAATCGTCTGATCACCCAGCGCGTCTCAGCAGCCATGTATAAGTCCCTAGAACTGGCGATTGGACGATTTGAAAGTGAAGATTTGACCTCCATAGTTGAGCTGGATGGCCTGTTGGAAATCAACCGCATGACCCACAAGCTGCTGAGCCGGTACCTGACGCTGGACGGCTTCGACGCCATGTTCCGGGAGGCCAACCACAACGTGTCAGCGCCCTACGGGAGGATCACCCTGCACGTCTTCTGGGAGCTCAACTATGACTTCCTGCCCAACTACTGCTACAACGGCTCTACCAACCGGTTTGTTCGGACAGTGTTACCATTTTCTCAGGAATTTCAAAGAGATAAGCAGCCTAATGCACAGCCTCAGTATCTGCATGGATCCAAGGCTTTGAACTTGGCCTACTCCAGCATTTACGGCAGCTACCGGAACTTCGTGGGACCTCCACACTTTCAAGTCATCTGCCGGCTTCTCGGCTACCAGGGTATCGCCGTGGTCATGGAGGAGCTGCTGAAGGTCGTCAAGAGCCTGCTGCAAGGCACAATCCTGCAGTACGTGAAGACGCTGATGGAGGTGATGCCCAAGATCTGCCGCCTGCCCCGGCACGAGTACGGCTCTCCTGGTATCCTGGAGTTCTTCCACCACCAGCTGAAGGACATCGTGGAGTACGCAGAGCTGAAGACGGTGTGCTTCCAGAACCTGCGGGAGGTGGGGAACGCCATCCTCTTCTGCCTGCTCATCGAGCAGAGCCTGTCTTTAGAAGAAGTGTGTGACCTGCTGCACGCGGCTCCTTTCCAGAACATCTTGCCGCGAGTCCATGTGAAAGAGGGGGAGAGACTTGATGCCAAAATGAAAAGACTAGAATCAAAGTACGCCCCGCTGCATCTTGTCCCACTGATTGAAAGACTGGGGACCCCTCAGCAAATTGCCATCGCAAGAGAGGGGGACCTGCTGACAAAGGAGCGCCTCTGCTGCGGCCTGTCCATGTTTGAGGTCATCCTGACACGGATCCGGAGCTTTCTGGATGACCCCATCTGGCGCGGGCCTCTGCCCAGCAATGGGGTCATGCATGTGGACGAGTGTGTGGAGTTTCACAGACTGTGGAGTGCCATGCAGTTTGTCTACTGCATTCCCGTGGGGACACACGAGTTCACAGTCGAGCAGTGCTTTGGTGATGGGCTACACTGGGCTGGCTGTATGATCATCGTACTTCTTGGGCAGCAGCGGCGTTTTGCTGTGCTGGATTTCTGCTACCATCTACTTAAAGTCCAGAAACATGATGGCAAAGATGAGATTATTAAAAATGTGCCTTTGAAGAAGATGGTGGAGAGAATTCGCAAGTTCCAGATTCTCAATGATGAGATCATCACCATCCTGGATAAGTACCTGAAGTCAGGCGACGGGGAGGGCACGCCAGTGGAGCATGTGCGCTGCTTCCAGCCGCCCATCCACCAGTCCCTCGCCAGCAGCTGAGGGCACGCGCTGCACTCCGTAACTCAACATGGCATGCCTTTCTCTCCGTAAACTATTTAGTGAGATTTTTAGGGACTATTTTTCAGTATCTCTGTACCTGTTAAAGGGGGTGCTTTTCGATCTAAAAACTTAATTTTATAAAATTGACTTATTTTTCTAGACTAAAATTGTATATGCTTTTGGTAATTAGGAACTCTTGAGAATATTGGCTGCTGATTGTTGCCATCACGTTCCTACAAAATTGTTTTTCTATGGGATGTTCTGGCAGCTGTGTCATAAAATGCTGCTGGGTTCATTCATTCATTCCATAAGAAACTTAATACCAGCAAATGCATTAAATCCCTTGCCAGTTACCATTAACTGTAACTATTTAGCTTTTGTTTAGGGATCTTTCTGATGGTCTTTTATGAGCAATCTTAGTTCTAAGTCATTGTTCCCATCCCTTTTTTGTGTGTTTCAGAAAATAGTGAACTTGATTCCCCTGCTTCCACTAAATCCAGTTGTGACAAAATCTAACGTGACATCAGATCGAAAG