Transcript asmbl_5526

Sequence
Transcript Sequence for observation asmbl_5526 of TGE0006361:
GTCTCCCCTGCTCAGCTTGTTGGGGCAGAAGCTGGGGCCCCGCGGAGGTAGCAGCTGCCGCTTGCAGACTAAGGCCGAGGTCCCTCCGGGTTTGGAGAATCTGACACACCCACTTTCCCGCCTGGGCTCTTGGTGCCCCCTGGCTGTCTGGCAAGATGAAACCTAAACTGATGTATCAGGAGCTGAAGGTGCCTGTTGAGGAGCCTGCCAGCGAGCTGCCCATGAATGAGATTGAGGCATGGAAGGCTGCGGAGAAGAAAGCCCGTTGGGTCCTGTTGGTCCTGATCCTGGCAGTTGTGGGTTTCGGTGCCCTGATGACTCAGCTGTTCTTATGGGAATACGGCGACTTGCATCTCTTTGGGCCCAACCAGCGCCCAGCCCCCTGCTATGACCCATGCGAAGCCGTGCTGGTGGAGAGCATCCCCGAGGGCCTGGACTTCCCCAATGCCTCCACGAGCAACCCCTCCACTAGCCAGGCCTGGCTGGGCCTGCTTGCTGGGGCCCACAGTAGCCTGGACATCGCCTCCTTCTACTGGACCCTCACCAACAATGACACTCACACTCAGGAGCCCTCTGCGCAACAGGGCGAGGAGGTCCTCCGGCAGCTACAGACCCTGGCGCCTCGAGGAGTGAAAGTCCGCATTGCCGTGAGCAAGCCCAGCGGGCCCCAGCCCCAGGCGGACCTGCAGGCCCTGCTGCAGAGCGGTGCCCAGGTCCGCATGGTGGACATGCAGAAGCTGACACATGGCGTCCTACACACCAAGTTCTGGGTGGTGGACCAGACCCACTTCTATATCGGCAGTGCCAACATGGACTGGCGCTCCCTGACCCAGGTCAAGGAGCTGGGCGTGGTCATGTACAACTGCAGCTGCCTAGCTCGAGACCTGACCAAGATCTTTGAGGCCTACTGGTACCTGGGCCAGGCGGGCAGCTCCATCCCATCAACCTGGCCCCGGCCCTATGACACGCGCTACAATCAAGAGACACCGATGGAGATCTGCCTCAATGGAACCCCTGCTCTGGCCTACCTGGCAAGTGCGCCTCCACCACTATGTCCAAGTGGCCGTACCCCAGACTTGAAGGCCCTGCTCAACGTGGTGGACAATGCCCGGAGTTTCATCTACATCGCAGTCATGAACTACCTGCCCACCATGGAGTTCTCCCACCCACGCAGGTTCTGGCCTGCCATCGACGATGGGCTGCGGAGGGCTGCCTACGAGCGGGGCATCAAGGTACGCCTCCTGATCAGCTGTTGGGGACACTCCGAGCCATCCATGCGGGCCTTCCTGCTCTCCCTGGCTGCCCTGCGTGACAACCACACCCACTCTGACATCCAGGTGAAACTCTTCGTGGTTCCTGCGGACGAGGCCCAGGCCCGAATCCCATATGCCCGCGTCAACCACAATAAGTACATGGTGACCGAGCGTGCCACCTACATTGGAACGTCCAACTGGTCTGGCAGCTACTTCGCAGAGACGGCGGGCACCTCGCTGCTGGTGACACAGAACGGGCGGGGTGGTCTGCGGAGCCAGCTGGAGGCCGTTTTCCTGAGGGACTGGGACTCCCCTTACAGCCATGACCTCGACACCTCAGCTGACAGCGTGGGCAACGCCTGTCGCCTGCTGTGAGGCCTGGCCCAGAGGACAGGCCGAGGCCTGCAAGGCCCCCGTGGACCCAGGAGTCCTGGGCCCTGACCCTGTCCCCATGCCCCCTGCTTCTGTCTGCCCCGTTGTGGCTCCACAGGCCCCCTGCTCTCCCACCTCTACCTCCGCCCCCACAGGCCTGACGCTGTGGCCCCAGGACCCAGCCGAGCTGGGGGAGAGATCAGCCCCCAAAGAAGTGGGGGTGCATGCTGGGCCCAGTCCCCCGGCCCACCCCCTTCCCAGGGCAAAGAGGGCCCAAGGTTATGATAAGAAGTAAATAACTTGTCTGTATA