Transcript asmbl_55076

Sequence
Transcript Sequence for observation asmbl_55076 of TGE0006510:
GGCGGGTGCCCGAGCTCGGAGCGCGCAGCTTTCTTTTTCTTTTTGAATTCCTGGTTTGCAGACAGCAATGGCAGCCCGAGTACTTGTAATTGGCAATGGAGGAAGAGAACATACACTGGCTTGGAAACTTGCACAGTCTGATCATGTTAAACAGGTGTTGGTTGCCCCAGGAAATGCAGGCACTGCCTGCTCTGAAAAGATTTCAAATGCTGCCATCTCCATCAGTGATCACAGCGCCCTTGCTCAATTCTGCAAAGATGAGGAAATTGAATTTGTAGTTGTTGGACCAGAGGCACCTCTGGCTGCTGGAATTGTTGGGAACCTGACATCTGCAGGAGTGCGATGCTTTGGCCCCACAGCAGAAGCGGCTCAGTTAGAGTCCAGCAAAAGATTTGCCAAGGAGTTTATGGATCGACATGGAATCCCAACTGCACAATGGAGAGCTTTCACCAAACCTGAAGAGGCCTGCAGCTTCATTATGAGTGCCAGCTTCCCTGCTTTGGTTGTGAAGGCCAGTGGTCTTGCAGCTGGGAAAGGGGTGATTGTTGCAAAGAGCAAAGAAGAGGCCTGCAAAGCTGTACAGGAGATCATGCAGGATAAAGCTTTTGGAGCAGCTGGAGAAACAGTTATCATTGAAGAACTTCTTGAAGGAGAAGAAGTGTCTTGTCTGTGCTTCACTGATGGAAGGACTGTGGCCCCCATGCCCCCAGCACAGGACCATAAGCGATTGCTAGAAGGAGATCACGGCCCCAACACCGGGGGAATGGGAGCCTATTGCCCAGTACCTCAGGTTTCTAAGGATTTGTTGCTAAAAATTAAAAATATCATTCTTCAGAGGACAGTGGATGGCATGCAGCAAGAGGGTACGCCATACACAGGTGTTCTCTATGCTGGTATAATGCTGACTAAGGATGGCCCAAGAGTTCTGGAGTTTAATTGCCGTTTCGGTGATCCAGAGTGCCAAGTCATCCTCCCACTTCTTAAAACTGATCTTTATGAAGTGATTCAGTCTACCTTAGATGGCCTGCTGTGTACCTCTCTGCCTGTTTGGCTTGAAAATCACACTGCTATAACTATTGTCATGGCAAGTAAAGGTTATCCAGGAGACTACACCAAGGGTGTGGAGATAACAGGGTTTTCTGAGGCTCAGGCTTTGGGACTGGAGGTGTTCCAAGCAGGTACTGCCCTAAAAGATGGCAAAGTGGTGACTAATGGTGGTAGAGTCCTTACAGTAACAGCCATCCAGGAAAATCTCATCTCAGCCCTTGAAGAAGCCAAGAAAGGACTAGCTGCTATAAAGTTTGAGGGAGCCATTTACAGAAGGGACATCGGCTATCGTGCCATAGCTTTCCTTCAGCAGCCCAGGGGCCTGACTTATAAGGAATCTGGGGTAGACATTGCAGCTGGAAATATGCTGGTCAGGAAAATTAAACATTTAGCAAAAGCCACCTCTAGACCAGGCTGTGATGTTGATCTTGGAGGTTTTGCTGGTCTTTTTGATTTGAAAGCAGCTGGTTTCAAAGATCCTCTTTTGGCCTGTGGAACAGATGGTGTTGGAACAAAACTGAAGATTGCCCAGCAGTGCAATAAACATGATACCATTGGTCAGGATTTGGTTGCAATGTGTGTAAATGATATTCTGGCACAAGGAGCAGAGCCCCTCTTCTTCCTTGATTACTTTGCCTGTGGAAAACTTGACCTCGATACAACTGAAGCAGTTGTTGCTGGAATTGCTAAAGCCTGTGGAAAAGCTGGATGTGCTCTCCTTGGTGGCGAAACAGCAGAAATGCCTGACATGTATACTCCAGGAGAGTATGACCTAGCCGGTTTTGCCGTCGGTGCCATGGAGCGGCATCAGAAACTCCCTCATCTGGAAAGAATCGCCGAAGGGGATGTTGTCATTGGAATAGCTTCATCTGGTCTTCACAGCAATGGGTTTAGCCTCGTGAGGAAAATTGTAGCGAAATCTTCCCTTCAGTACTCCTCCCCAGCACCCGATGGCTGCGGTGACCAGACATTAGGAGACTTGCTTCTAACTCCAACCAGAATCTACAGCCATTCACTCTTACCTGTATTACGTTCAGGACACGTCAAGGCCTTTGCCCACATTACTGGTGGAGGATTGCTAGAAAACATCCCCAGAGTCCTCCCTCAGAAATTTGCGGTGGATTTAGATGCCCAGACCTGGAGGATCCCCAGGATCTTCTCGTGGTTACAGCAGGAAGGACAGCTGTCTGAAGAAGAGATGGCCAGAACATTTAACTGTGGGGTTGGGGCTGCCCTCGTGGTATCAAAGGACGTGACAAAGCAGATTCTGAAGGATATTCAGCAGCACCAGGAAGAAGCTTGGGTGATTGGCAGGGTGGTGGCATGTCCTGAAGGTTCTCCTCGTGTGAAAGTCAGGCACCTAATCGAAGCCATGCAGATAAATGGATCAGTATTGGAGAATGGCACCCTGAAAAGCCATTTCACTGCCCAACCAAAAAAGGCAAGAGTGGCTGTCTTAATATCTGGAACAGGATCCAACCTCCAAGCTCTGATAGACAGCACTCGGGAGCCGAGCAGCTGTGCACACATTGTTGTCGTCGTCTCCAACAAAGCAGCGGTGGCTGGCTTAGATAAAGCAGCGAGAGCTGGAATTCCTACCAGAGTAATTAATCATAACTTATATAAAAGTCGTGTAGAATTTGACACTGCAATTGACCAAGTCCTTGAAGAGTTCTCCACAGACATAGTCTGTCTCGCAGGATTCATGAGAATTTTATCTGGCCCCTTTGTCAGAAAATGGAATGGGAAAATGCTCAACATCCACCCTTCCTTGCTCCCTTCTTTTAAGGGGTCAAATGCCCACGAGCAAGCCCTGGGTGCCGGTGTCAAAGTAACTGGGTGCACGGTGCACTTTGTAGCTGAAGAAGTAGATGCTGGACAAATTATTTTGCAAGAAGCTGTTCCTGTGAAGAGGGGTGACACTGTTGCAACTCTGTCTGAAAGAGTGAAATCAGCAGAGCATAAAATATTTCCCGCAGCCCTCCAGCTGGTGGCCAGTGGAACTGTGTGGCTTGGAGAAAATGGCAAACTCTGTTGGGTTAAGGAGAAATGAAGCTGCCTAATTCAGGAATGGAGCCAGTTTTGAAAGAAGTCTAGCTGTTTACATGGTGGCTTTTTTATCATAGACTCGTCCCAAAATAATGGCTGAAAAAGAGGACCTCACCCTTATTTCTTTGGCTGTTTTTTACATGAACAAAAATTCATTCCAAGCAAGACTGGTGCAGCATATCTAAGATATATATCTGCTTCATTGGTCTTCCAGGTTTTACCTGTTTACGACCTTGTTCAGAATCAAGCTAGTCATTCAGAACACCTTTCATTTTCAGCCAGATACTAAAATTCTTACTCTTTCTTTTTCTGACCAATATTTTTTTTTAGTTATATGTTTTCTAATCTTTGAAGAGTTAACCAACAAGTCTAATAATAAATTAATCTCTCTGTTGTTTTGAAGTGAGACTTCTCTTATTATCC