Transcript asmbl_55075

Sequence
Transcript Sequence for observation asmbl_55075 of TGE0006510:
GGCGGGTGCCCGAGCTCGGAGCGCGCAGGTGAGCGTGCGAGTTCGAGCGGCCAGACTGCATTTTGTCGGCATTGTGTCGCTTTCTTTTTCTTTTTGAATTCCTGGTTTGCAGACAGCAATGGCAGCCCGAGTACTTGTAATTGGCAATGGAGGAAGAGAACATACACTGGCTTGGAAACTTGCACAGTCTGATCATGTTAAACAGGTGTTGGTTGCCCCAGGAAATGCAGGCACTGCCTGCTCTGAAAAGATTTCAAATGCTGCCATCTCCATCAGTGATCACAGCGCCCTTGCTCAATTCTGCAAAGATGAGGAAATTGAATTTGTAGTTGTTGGACCAGAGGCACCTCTGGCTGCTGGAATTGTTGGGAACCTGACATCTGCAGGAGTGCGATGCTTTGGCCCCACAGCAGAAGCGGCTCAGTTAGAGTCCAGCAAAAGATTTGCCAAGGAGTTTATGGATCGACATGGAATCCCAACTGCACAATGGAGAGCTTTCACCAAACCTGAAGAGGCCTGCAGCTTCATTATGAGTGCCAGCTTCCCTGCTTTGGTTGTGAAGGCCAGTGGTCTTGCAGCTGGGAAAGGGGTGATTGTTGCAAAGAGCAAAGAAGAGGCCTGCAAAGCTGTACAGGAGATCATGCAGGATAAAGCTTTTGGAGCAGCTGGAGAAACAGTTATCATTGAAGAACTTCTTGAAGGAGAAGAAGTGTCTTGTCTGTGCTTCACTGATGGAAGGACTGTGGCCCCCATGCCCCCAGCACAGGACCATAAGCGATTGCTAGAAGGAGATCACGGCCCCAACACCGGGGGAATGGGAGCCTATTGCCCAGTACCTCAGGTTTCTAAGGATTTGTTGCTAAAAATTAAAAATATCATTCTTCAGAGGACAGTGGATGGCATGCAGCAAGAGGGTACGCCATACACAGGTGTTCTCTATGCTGGTATAATGCTGACTAAGGATGGCCCAAGAGTTCTGGAGTTTAATTGCCGTTTCGGTGATCCAGAGTGCCAAGTCATCCTCCCACTTCTTAAAACTGATCTTTATGAAGTGATTCAGTCTACCTTAGATGGCCTGCTGTGTACCTCTCTGCCTGTTTGGCTTGAAAATCACACTGCTATAACTATTGTCATGGCAAGTAAAGGTTATCCAGGAGACTACACCAAGGGTGTGGAGATAACAGGGTTTTCTGAGGCTCAGGCTTTGGGACTGGAGGTGTTCCAAGCAGGTACTGCCCTAAAAGATGGCAAAGTGGTGACTAATGGTGGTAGAGTCCTTACAGTAACAGCCATCCAGGAAAATCTCATCTCAGCCCTTGAAGAAGCCAAGAAAGGACTAGCTGCTATAAAGTTTGAGGGAGCCATTTACAGAAGGGACATCGGCTATCGTGCCATAGCTTTCCTTCAGCAGCCCAGGGGCCTGACTTATAAGGAATCTGGGGTAGACATTGCAGCTGGAAATATGCTGGTCAGGAAAATTAAACATTTAGCAAAAGCCACCTCTAGACCAGGCTGTGATGTTGATCTTGGAGGTTTTGCTGGTCTTTTTGATTTGAAAGCAGCTGGTTTCAAAGATCCTCTTTTGGCCTGTGGAACAGATGGTGTTGGAACAAAACTGAAGATTGCCCAGCAGTGCAATAAACATGATACCATTGGTCAGGATTTGGTTGCAATGTGTGTAAATGATATTCTGGCACAAGGAGCAGAGCCCCTCTTCTTCCTTGATTACTTTGCCTGTGGAAAACTTGACCTCGATACAACTGAAGCAGTTGTTGCTGGAATTGCTAAAGCCTGTGGAAAAGCTGGATGTGCTCTCCTTGGTGGCGAAACAGCAGAAATGCCTGACATGTATACTCCAGGAGAGTATGACCTAGCCGGTTTTGCCGTCGGTGCCATGGAGCGGCATCAGAAACTCCCTCATCTGGAAAGAATCGCCGAAGGGGATGTTGTCATTGGAATAGCTTCATCTGGTCTTCACAGCAATGGGTTTAGCCTCGTGAGGAAAATTGTAGCGAAATCTTCCCTTCAGTACTCCTCCCCAGCACCCGATGGCTGCGGTGACCAGACATTAGGAGACTTGCTTCTAACTCCAACCAGAATCTACAGCCATTCACTCTTACCTGTATTACGTTCAGGACACGTCAAGGCCTTTGCCCACATTACTGGTGGAGGATTGCTAGAAAACATCCCCAGAGTCCTCCCTCAGAAATTTGCGGTGGATTTAGATGCCCAGACCTGGAGGATCCCCAGGATCTTCTCGTGGTTACAGCAGGAAGGACAGCTGTCTGAAGAAGAGATGGCCAGAACATTTAACTGTGGGGTTGGGGCTGCCCTCGTGGTATCAAAGGACGTGACAAAGCAGATTCTGAAGGATATTCAGCAGCACCAGGAAGAAGCTTGGGTGATTGGCAGGGTGGTGGCATGTCCTGAAGGTTCTCCTCGTGTGAAAGTCAGGCACCTAATCGAAGCCATGCAGATAAATGGATCAGTATTGGAGAATGGCACCCTGAAAAGCCATTTCACTGCCCAACCAAAAAAGGCAAGAGTGGCTGTCTTAATATCTGGAACAGGATCCAACCTCCAAGCTCTGATAGACAGCACTCGGGAGCCGAGCAGCTGTGCACACATTGTTGTCGTCGTCTCCAACAAAGCAGCGGTGGCTGGCTTAGATAAAGCAGCGAGAGCTGGAATTCCTACCAGAGTAATTAATCATAACTTATATAAAAGTCGTGTAGAATTTGACACTGCAATTGACCAAGTCCTTGAAGAGTTCTCCACAGACATAGTCTGTCTCGCAGGATTCATGAGAATTTTATCTGGCCCCTTTGTCAGAAAATGGAATGGGAAAATGCTCAACATCCACCCTTCCTTGCTCCCTTCTTTTAAGGGGTCAAATGCCCACGAGCAAGCCCTGGGTGCCGGTGTCAAAGTAACTGGGTGCACGGTGCACTTTGTAGCTGAAGAAGTAGATGCTGGACAAATTATTTTGCAAGAAGCTGTTCCTGTGAAGAGGGGTGACACTGTTGCAACTCTGTCTGAAAGAGTGAAATCAGCAGAGCATAAAATATTTCCCGCAGCCCTCCAGCTGGTGGCCAGTGGAACTGTGTGGCTTGGAGAAAATGGCAAACTCTGTTGGGTTAAGGAGAAATGAAGCTGCCTAATTCAGGAATGGAGCCAGTTTTGAAAGAAGTCTAGCTGTTTACATGGTGGCTTTTTTATCATAGACTCGTCCCAAAATAATGGCTGAAAAAGAGGACCTCACCCTTATTTCTTTGGCTGTTTTTTACATGAACAAAAATTCATTCCAAGCAAGACTGGTGCAGCATATCTAAGATATATATCTGCTTCATTGGTCTTCCAGGTTTTACCTGTTTACGACCTTGTTCAGAATCAAGCTAGTCATTCAGAACACCTTTCATTTTCAGCCAGATACTAAAATTCTTACTCTTTCTTTTTCTGACCAATATTTTTTTTTAGTTATATGTTTTCTAATCTTTGAAGAGTTAACCAACAAGTCTAATAATAAATTAATCTCTCTGTTGTTTTGAAGTGAGACTTCTCTTATTATCC