Transcript asmbl_55068

Sequence
Transcript Sequence for observation asmbl_55068 of TGE0006507:
AGAAAATTAAAAATGTACTTTAAAAGACTTCCAAGTACTTTATTCTAAAACTTTTCACATTTCTTTTTACTAATATTGAAGTGTTAAGTTTCCTAACCACACCTTTGCTCCAATAAATAGGCACTGGACATTATAGCTCTATATGGATTAAAAGAAGTGATAATTCCTAAACATTGTAAAAATGAATTGCTATTTGTGTCAATCTATTGAGAATTCATGATGATTCTGTCCATAGAGGGTACTTTTTCAGAAATCCGGAAATAGACTGGAACCCTCAAATAAGTAAGCAGCTGAGGAGTTTGGTGTTACGGAGTGTGTTGTATTTTTACAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGC