Transcript asmbl_55066

Sequence
Transcript Sequence for observation asmbl_55066 of TGE0006507:
TGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGTGCATTTGAATTTTAGCATCCCGTCATTATATTTAAAATCCCACATATGTGAGTTATATATGCAATAAAGAATACGCCTTGCTGATCAGCCACACCCAAGCAATTTAATATCCGTGGTCTTCTATAATGTTTATACCACATTGTAAATATTCAGAGAACTTGTTTTAAAGTTTATGCTTTCTGATTCTGTGATTTTCAAAAGAGGAATTTTTGGAAATTAAGGACTATTATTTGATAATTATATATGTAATTAAGC