Transcript asmbl_26495

Sequence
Transcript Sequence for observation asmbl_26495 of TGE0004542:
TAAAAGTACCGGGAAAAGGGTAAAGGAGCGACTCCAGCCCGCCGCTTCCTCAACTTGGGGCTCGCTGTCTCCGGCTCCGCTCGGGTAAGGGGCTCTGCAGCGACGTGCGCGGAGAGGGGCCACCGTGGGAAACTGGCCCCAGAAGAGCCAGGGCGGACTCCTGCTTCCAAGAGTCTCCGGCTTGTCGCTCCTCACGGCCCAGTGCCCCCTCCATCAGGTCCTCCAGCCAGAGGACAGGCATGGCGAGGCCGGGAGGCTCCTGCCTTTGCAGCTGTTTGGCTGTGCTCTGCCTCCTCCCCTCGCTGAGCCTGGCGCAGTACGAGAGCTGGCCCCACTACCCCGAGTACTTCCAGCAGCCGGCTCCCGAGTACCACCGGCCTCAGGTGCCCTCCGACGTCACCAAAATCCAGCTGCGCCTGGCGGGTCAGAAGAGGAAGCACAGCGAGGGGCGGGTGGAGGTGTACTACAACGGCGAGTGGGGCACCGTGTGCGACGACGACTTCTCCATCCACGCGGCGCACGTCGTCTGCCGGGAGCTGGGATACGTGGAGGCCAAGTCCTGGACCGCCAGCTCCTCCTATGGCAAGGGGGAAGGCCCCATCTGGTTGGACAATATCTACTGCACTGGCAAAGAGGCGACCCTTGCAGCCTGCTCCTCCAATGGCTGGGGTGTCACCGACTGCAAGCACACAGAAGACGTGGGTGTGGTGTGCAGTGACAAAAGGATTCCTGGGTTCAAATTCGACAATTCCTTGATCAACCACATAGAGAACCTGAACATCCAGGTGGAAGACATCCGCATCCGAGCCATCCTCTCCGCCTACCGAAAGCGCACCCCTGTGACGGAGGGCTACGTGGAAGTGAAGGACGGCAGGGCCTGGAAGCAGATCTGCGACAAGCACTGGACGGCCAAGAATTCCCGTGTGGTCTGCGGCATGTTTGGCTTCCCTGGGGTGAAGACGTACAACACCAAAGTGTACAAAATGTTTGCTGCCCGGAAGAAGCAGCGCTACTGGAGGTTCTCCATGGACTGCACGGGCACAGAGGCCCACGTCTCCAGCTGCAAGCTGGGCCCTCGGGTGTCCCGGGACCCCGTGAAGAACATCACCTGTGAGAATGGGCTGCCGGCTGTGGTGAGCTGTGTGCCTGGCCAGGTCTTCAGCCCTGATGGACCCTCAAGATTCCGGAAAGCTTACAAGCCAGAGCAACCCCTGGTGCGGTTGAGAGGTGGTGCCAACGTCGGGGAGGGCCGCGTGGAGGTACTCAAGAATGGAGAATGGGGTACCATCTGTGACGACAAGTGGGACCTGGTGTCTGCCAGCGTGGTCTGCAGAGAGCTGGGCTTTGGGAGTGCCAAAGAAGCCATCACTGGCTCCCAGCTGGGGCAAGGGATAGGACCCATCCATCTCAATGAAATTGAGTGCACGGGGAATGAAAAGTCCATCATAGACTGCAAATTCAATGCTGAGTCTCAGGGCTGCAACCATGAGGAAGATGCTGGTGTGAGATGTAATATCCCCGCCATGGGCTTCCAGAAGAAGCTGCGCCTGAACGGGGGCCGAAACCCCTACGAGGGCCGGGTGGAGGTGCTGGTGGAGAGGAACGGGTCCCTCATATGGGGGACGGTGTGTGGCGAGAACTGGGGCATTGTGGAGGCCATGGTGGTCTGCCGGCAGCTGGGCCTGGGGTTCGCCAGCAGCGCTTTCCAGGAGACCTGGTATTGGCACGAAAACATCAATGCCAATAAAGTGGCCATGAGCGGAGTGAAGTGCTCTGGAACGGAGCTGTCCCTGGAACACTGTCGCCATGACGAGGATGTGGCTTGCCCCCAGGGCGGAATGCAGTACGGAGCTGGAGTCGCCTGCTCAGAAACCGCCCCTGACCTGGTCCTCAATGCGGAGATCGTCCAGCAGAGCACCTACCTGGAGGACCGACCCATGTTCATGCTGCAGTGCGCCATGGAGGAGAACTGCCTCTCGGCCTCGGCCGCCCAGACCAACCCCACCTCAGGCTACCGGCGGCTGCTTCGCTTCTCCTCCCAGATCCACAACAATGGCCAGTCCGACTTCCGGCCCAAGAACGGCCGCCATGCGTGGATCTGGCATGACTGCCACAGGCACTACCACAGCATGGAAGTGTTCACCCACTATGACCTCTTGAACCTCAATGGCACCAAGGTGGCAGAGGGCCACAAAGCCAGCTTCTGCTTGGAGGACACAGAATGTGAAGGAGATAGCCAGAAGAGCTACGAGTGTGCCAACTTTGGTGAGCAGGGCATCACCATGGGCTGCTGGGACGTGTACCGCCATGACATCGACTGCCAGTGGGTGGACATCACAGATGTGCCTCCCGGAGACTACTTGTTCCAGGTTGTCATCAACCCCAACTATGAGGTTGCAGAATCTGACTACACCAACAACATCATGAAATGCAGGACCCGCTACGACGGCCACCGCATCTGGATGTACAACTGTCACATAGGTGGTTCCTTCAGTGAAGAGACAGAAAAGAAGTTTGAACACTTCAGTGGACTCATAAATAACCAGCTCTCTACGCGGTAAGGCAGCCTACATGGTCACGTGGTCACCTCCTGCCTTTGGGCCACAGCGCATCTTCCCCAACAACTGCAGTCCGACGGACGATCACCACACTCCCCCTCGCCTAGCCCGGCCCCGCCCCATCTGGATACCCTGCGGCCACATCTCAGCTCAAGAGGAATGGGTGTTCCTGACATTTGCTGGGGGCTGCTGCCTGAGCCTGGGAAGGTGTCTGGGAGTGGGCCTTGTCCGCAGGGCTGTGGGAGCAGTGCCACGGGCCATCTTGTCCGGGACCCCAGGCACACAGGTTGTCATCAGCTTGTCCCATCCAAACCAGTCACACCTGCCCCACACCCCACCCCATCCCCAGTCTGACACCACCCCCATCAGCTCACCACAGATAATATGGGGCCATTCTCTCCTCAAATTCCATGTCGGCAAAGCCAGTTTATCGCCCGAGGTGGTCAGGCTGAATCCCATTTCTCCTCCTCTTGGGTCATCTGCAACCAACTTGAACGTCTAGAGCTCTCTTCCAGTTAAACGAACTGCCTGTCCTCTCCTCTCTCTGTTCACGTATATAAAAAATGCTGCCACATTTTCTGATGAAGTGAGCTCAGAGCTGGTACTTCTCCCCTACCCTCAACTCTACATCCTATTTTTCAAGATACCATTATTATATTTTCACGAACTTTGAAACACAAATTAATTTAGTGGCATTTAATATTGGGCATCTGGGCCTTTGGAAGGAAAAACCTGCCCACCTGTGTAAGTGACTCATGGTTCTGTTGTTCTGATTCTGTGGGTAACTGATTCAACGGTGCTATAACCAGGGTCCTGGGTGACAAGGACACTCACCAAACGCCATGTGTCATCACAGACACTTACACATACTTGAAACTTGGAATAAAAGATTTATGATTTG