Transcript asmbl_54242

Sequence
Transcript Sequence for observation asmbl_54242 of TGE0006453:
CCCCCCTGGGGACGGTGTGAACTGAGCTTGGCTCCGGCTTCTCTGCGGCCTTGCCGTGGGCCTGGTTCGTTCCTCCGTCGTCCTGCTAACGTGGCAAGTGCCACAGTTTCAATCTGGGAAGCCTTTAAATGAAACTTGCTTAAAATCTTAGATCGTACACAGAAGAGAGACCTCGATCAACGTCGAAAAGAAAGATGATGTCCTTAAACAACCTACAGAATGTCACCTATAACCCGATAATCCCCTATGTTGGGACCATCCCTGAACAGTTGGAGCCTGGAACTTTGATTGTGATACGTGGGCATGTTCCTGGTGACTCGGACAGATTCCAGGTGGACCTCCAGAATGGCAGCAGTGTGAAGCCTCGGGCTGACGTGGTCTTTCATTTCAACCCACGTTTCAAAAGGTCCAACTGCATTGTTTGCAATACTCTGAAAAATGAGAGATGGGGACGGGAAGAGATCACCTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGATTTAGGAAGTACCCAAGCATCTACTCTGGAACTGACAGAGATAAGTAAAGAAAATGCTTCCCAGTGCTGACAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTCTGTGAGGCACAGGCGGAAGAAATTTGAAGCAACAGAAGCGTACAGCCATTGCTGAGGCCTTCCTCGCCCCCTGGCCTCGTCTGGAGCCCACTTCCCACTGAACAAGCACTTACGCGGCGCCTGCTCTCACAGCCTCAACGCGCCAAGCACATCCCTTTGCCAGCACCGTGCTGGGGGCCGGGGTGCACGCACGGTGGTGCCCTGGACTGTGCTCCCCGTTCTCTTGAGCTCAGAATCCTGTGTGCTCTGCCCTGTGCACTGTTTCTTCTGCAGGTATCGCATACTCACCAGGGACTTAGAACTGCTCAGCTGTTAAATCACCTAGAAACTAATTCAAAGACAGTACTCTGGCCCCAGTGGTCACACTCAGCGTCATATCTCATAGCTAAGGGGTCGATTTTGACTCCCATCTGGCACTTTCCTTTAGCATAATAAATATCTAGCCCTACTAGCTGTAAGCATTACCAAGTAGTGAACACTATGAAGTCTGAACACAGCACAAAAATTAAGGCAAAAGAATAATCAAGCAAAACAAAAACGAATGTATTGAAATTAACCTGATCTCATTCGCAAGGCCACTGATTTCCGTATCAGTAAATGGTTATTTTAGAACATGTGAATTTAGGTTGAGTCAAAGGTCTGCACGTGCCTCTACAGAAGGTTTAAGGTGGAAGAGGATTTCCATTAGTACAATGTTTATAGGTGACAAAGCATAGCCAAGGTCTGGTTTAATGGCTGCTTCTGAAAGAGGCACGATCGGAAAGTGAAATGCAGCCACTGAGGGCAGGGAGGAGCGTGCGCACCCGTCCTCCGCACGCGAACCAGCACCGCCTCTGCTCTTCCCAGGGATAGTCCATCACGTTAGCGACCGAGATCAAAACATTATTCTACTTTAAGTGATTAAAATCAAACCTGTATCAGCAAGTTAAATTGTTGCGTTCTGTAATTTTTTCTATTCTTTGAAGCGAGTTGGCAGAAATTCTTTGTGGAATTCTTACAGGTCAGATCTTGTTCAAGGAAAATTCAAAGGCTTGGAGTGGGGAGGTAAAAAGCTAAATCAGCCGAATCATTTTATCATATTAAATTGCTGGGCTAGATTCTGCCAGGACTTAGGAGCATTTTCATAACAGGTTTCGGTTAGATACTATTTGTGTCCGTATACGGAAAATGCTATTACTGATCTTGTTTTTAAAAAGTACTCAGCGTAGGAACTTCTAGCACTTGATTCTTTTCCACTTTGTGTTAACTTATTATGCTGAGTTTGCCAAGCTCAAAAAAGACATGGGTGGGAGGGTGTTTGAGAAAGTTGTAGAGGACAAGAAGGCTCTAGAATCCCCAGAGTTATTTTTTTCCCTGCATAAAAGAACATCAGATTGCATGACTGGGGTTTTCCTCTCAGTCTTAAACACATTTTCATTTTCGTGATGTAAATGGGAGACATGACTAAGACAGAAGACTGTTTCCTGAGAAAATATAAAATCTTAAGGTGTTTTTTGACGTGAAGCTATTAGCATTTATCTTATCGAAACGTTTCTTGAAGAGAAACGTGCATTTACCATGTTGCCTG