Transcript asmbl_53843

Sequence
Transcript Sequence for observation asmbl_53843 of TGE0006437:
GGTTTGCCTGCAATGAAAGTTCGTTCTCTACAGCTAAAGGACATCCTTTCTGAGCTGCTGTGAATAAATTTGGAATGATACTGTATATTTTCATCTAATGGAGAATTAGCTATACCTTGAAAAAGGATTGCTGCACTGGACAACTTCAGACTATTGCTCACAATGTCATCAAACAGGAGTCAGAATCCCCATGGACTGAAGCAGATTGGCCTTGACCAGATCTGGGACGACCTCAGAGCTGGAATCCAGCAGGTGTACACCAGACAGAGCATGGCGAAATCCAGATACATGGAACTCTACACTCACGTTTATAACTACTGCACGAGTGTTCACCAGTCAAACCAAGCGCGAGGGGCTGGCGTCCCTCCTTCTAAATCAAAAAAGGGGCAGACGCCTGGGGGAGCCCAGTTTGTTGGCTTGGAGTTATATAAACGACTTAAGGAATTTTTGAAGAATTACTTGACAAACCTTCTTAAGGATGGAGAAGATTTGATGGATGAGAGTGTACTGAAGTTCTATACTCAACAGTGGGAAGATTACCGATTTTCAAGCAAAGTGCTGAACGGAATTTGTGCCTACCTCAATAGACACTGGGTTCGCCGTGAATGTGATGAAGGACGGAAAGGAATATATGAAATCTATTCTCTCGCGTTGGTGACTTGGAGAGATTGTCTGTTCAGGCCATTGAATAAACAGGTAACAAATGCTGTTTTAAAACTGATTGAAAAGGAAAGAAATGGTGAAACCATCAATACAAGACTGATTAGTGGAGTCGTACAGTCTTACGTGGAATTGGGGCTAAATGAAGATGATGCGTTTGCAAAGGGCCCTACGTTAACAGTGTATAAAGAATCCTTCGAGTCTCAGTTTCTGGCTGACACAGAGAGATTTTATACCAGAGAGAGCACCGAATTCTTGCAGCAGAACCCGGTTACTGAATATATGAAAAAGGCAGAGGCCCGTCTGCTCGAGGAGCAGCGGAGAGTGCAGGTTTACCTTCACGAGAGCACCCAGGACGAGCTCGCACGGAAGTGTGAGCAAGTGCTCATTGAGAAGCACCTGGAAATTTTCCACACAGAGTTTCAGAACCTGTTGGATGCTGACAAAAATGAAGATCTGGGTCGCATGTATAATCTTGTGTCTAGAATCCAGGATGGCCTAGGAGAATTGAAGAAACTTTTGGAGACGCACATTCATAATCAGGGTCTTGCAGCAATTGAAAAGTGTGGAGAAGCTGCTTTAAATGACCCCAAAATGTATGTACAGACAGTGTTGGACGTTCATAAAAAGTACAACGCCCTGGTCATGTCCGCGTTCAACAACGATGCGGGCTTTGTGGCCGCACTGGACAAGGCTTGCGGTCGCTTCATAAACAACAACGCAGTTACCAAAATGGCACAGTCGTCCAGTAAATCCCCTGAGCTGCTGGCCCGATACTGCGACTCCTTGTTGAAGAAGAGCTCCAAGAACCCAGAAGAAGCAGAACTAGAAGATACGCTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAGGATAAAGACGTGTTTCAGAAGTTCTACGCAAAAATGCTGGCCAAAAGACTGGTGCATCAGAACAGTGCAAGTGATGATGCCGAAGCAAGCATGATCTCTAAACTAAAGCAAGCCTGTGGCTTCGAGTACACCTCTAAGCTGCAGCGGATGTTCCAGGACATCGGCGTGAGCAAAGACCTGAACGAGCAGTTCAAAAAGCACCTGACGAATTCAGAGCCGCTAGACTTGGATTTCAGTATTCAGGTTCTGAGTTCCGGATCGTGGCCCTTTCAGCAATCCTGTACATTTGCCCTGCCGTCGGAGCTGGAACGTAGTTATCAGCGCTTCACAGCTTTTTATGCTAGCCGTCACAGTGGCCGAAAGTTGACATGGTTATATCAGCTGTCTAAAGGAGAATTGGTAACAAACTGCTTCAAAAACAGATACACTTTGCAGGCATCCACGTTCCAGATGGCGATCCTGCTGCAGTACAACACAGAAGACGCGTACGCCGTGCAGCAGTTGGCGGACAGCACTCAGATCAAAATGGACATTTTGGCACAAGTCCTACAGATTTTATTGAAGTCGAAGTTATTGGTCTTGGAAGATGAAAATGCAAACGTCGATGAGGTGGAACTGAAGCCAGACACCTTGATAAAATTGTATCTTGGTTATAAAAATAAGAAATTAAGGGTTAACATCAATGTGCCAATGAAAACTGAACAGAAGCAGGAACAAGAAACCACACATAAAAATATTGAGGAAGATCGCAAACTCCTGATTCAGGCAGCTATTGTGAGAATTATGAAAATGAGGAAAGTTCTGAAACACCAGCAGTTACTTGGAGAAGTGCTCACGCAGCTGTCCTCGCGGTTCAAGCCTCGGGTCCCAGTAATTAAGAAATGCATTGACATTCTGATCGAGAAAGAATATTTGGAGCGAGTGGATGGTGAAAAGGACACCTACAGTTACTTGGCTTAACCCTTCCAGAAGTGTCTGACTGTGCGACCCTCCACACATAGTTCCCGGTGGAAAGGATGAAAACTCGAGCTCATAGCAGCCAGTCTGCCGCCATTTGAACCTCCCTTTTTAAAACTGAGACCAAGACTCCCATCAGCCAGTCTCAGATGTACATCAGAACTGCTCAGGATTGATACATTTCAAGTCTGTAAATATAGACACCGACGCCATTTAACCTAATTTAAGAACAGAGGGGAACCGAACCCTCCACGCCGAGGGCTGCATGCTACTGCATTCAAATCGATACGCTGGCTCCGGGGCTCACAGCTGCCGCCTGAGGCAGCACTTACAGTGTTGGCAGCACTTTGAAAGCGAGTCTGAATGGACCCACGTGTAATCTGCTATGAAAACCCATTTGTATAGTGTGTTTCATTTTTTAATGTGTGAAAATAAAGAAAATTAAAG