Transcript asmbl_53813

Sequence
Transcript Sequence for observation asmbl_53813 of TGE0006435:
CTGTATCCTCGCTTATTCTGCTGTCTATAACGGAAGTTTTGTAGGTTTCGCAACGGTGGTTTCACTTTTGTTAAAACGTTAAGCGGGGTGGAGTAGACTCTCTGGAATACACGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAGGAGGAGGGTGGGCAGGGGACAGGGACCTGGACGGTGAGAGGAGGAGACTGGGGGCGGGGGCGTGGGTGCTGGTCCTGACAGGTGATCTGAGGACGGAGCCGCCTGCGGCCTGCTCTGCCATCCCCGGCCGCCAGCCGGGTCTGCAGTGTGACGCCGCGCCCACTGGGTCCTTTCCCCGCAGAGTGAAAGGGACTGGGGAATAGGGTGGCCCTGCGGAAGGGCTTGGGGTGGCGAGTTAACGGGGAGAGCGAGCTCCCATCGGTCTCTCTTCTGCCCTCCTGGGCCCCCTGACGGGTGGGGGTGCCACTTCACTGCTGATCTTTTCCTTCTTCCCATGATGCAGCTCTGCCTTCCTGCTTCCTCCTCGCTGTCCCGCCCCGATTGTCCTTCAAATCTTCAGTCATTCCAGGTGCTTTGGGGGCATAAAGGTGAGGCGGCGGCTCCAGTGGCCATACCAAATCGTGCCCGGACACTTTCAGCCCGAAACCAGTGTTTCAAGCTCTTAGTGTAGTTAAATATGCACTTGAAATTCAGAATTTATATGTATTGAGAATTCTTCACAAAAGTAAAATCTTTTATTAAATCAGAAAGTTTTAAATGCTAACAGAAGCAACTTATTTTTAATTAGCATTTTCAGACTCTGCTATCATGTTAAACTCAACGCTGGCTAAGATACCTACCAGAGATCAAGGCATATTTTCTCCAGGTTTTGTGGGGTTTTTTTGGTACATCTATATTACAGAAGACTATTTCTAAAGATACGTGTTTGGCCTCTTAATTGGCCCGACTAACCATTCTCGTCGCGCCGTGAATGCCTCTGTAGTTGTCTATTAATCGAGAACTCATCCCAGCACCAAGACACAGCTGGTGGCGTCGGGGACAGACTGACTCAAGTACCGGATGTGTTCCCAGGACTCTTCCTGCCGTCCCGGAAGTCGCTGGACATTCCTATGACAGGGCAGATGGCTCACTGCCGTGTCCCGTCGGGGCTGGCTGAAATGCTTTGACTTTTTCACTTACTGTTTTCATGACGCTTGGACAGCAGTCCAATTGGAATGGGTGGAAATGTGATTCTTTTAAAATGGATGATTCAGAAAGAAATAAAAGGTAG