Transcript asmbl_53717

Sequence
Transcript Sequence for observation asmbl_53717 of TGE0006414:
GTCTTTAGCAAGACCCAGCCTGGCGCTGGGCTGATTCATTCCGGGGCTGGAGCTGGGGGAGCCGACGTCGCCTCCTGCGCTGGGCTCAGCCTCGCTTCTAATTGGCCACCTTCGGGGCCGCCCTCCTGCGCGCACCAGCCCTGGGTTCCCTCCGCGGTCCGCACTGGTAAAGCTATCCTCTTCCTTCTTGACCCCTGGCGGTTCCTCCCTCCCTTCCTTCCCTCCCGCTGCCGCCGTCGCTTCTGGCACCACTGCTCCCGGAGGAGCCTTCCGGCTGGGTGATGGGGTCTCGGGCCTCCACGTTACTGCGGGATGAAGAGCTCGAAGAGATCAAGAAGGAGACTGGCTTTTCCCACAGTCAGATCACCCGCCTCTACAGCCGGTTCACTAGCCTGGACAAAGGAGAGAACGGGACTCTCAGCCGGGAAGATTTCCAGCGGATTCCAGAACTTGCTATCAACCCATTGGGGGATCGGATCATCAATGCCTTCTTTCCAGAGGGAGAGGACCAGGTAAACTTCCGTGGATTCATGAGAACTCTGGCTCATTTTCGGCCCATTGAGGATAATGAAAAGAGTAAAGATGTGAATGGACCAGAACCACTCAACAGTCGAAGCAACAAACTACACTTTGCTTTTCGACTATATGATTTGGATAAAGACGACAAGATTTCCCGTGATGAGCTGTTACAGGTCCTACGCATGATGGTCGGAGTGAATATCTCAGATGAACAGCTGGGCAGTATTGCAGACAGGACCATCCAGGAGGCTGATCAGGATGGAGACAGTGCCATATCTTTTACAGAATTTGTTAAGGTTTTGGAGAAGGTGGACGTAGAACAGAAAATGAGCATCCGGTTTCTTCACTAAAGGACTGAGATCAAACTGTTTCGTGCTTTCTAGTATTTAAGAACTGGAACCTGAGAATCCTCCTGTCCACCAACCCCACCTCCATTCCATCATTCCCCTTCTCCCTAAGTACCAAGGCTGTTGCATGATAACTCAGATATGTTCTATCAACACAAACCTGCCTTTGGTGTATAAACAGGGCATTATAGAATGGTACACCTGGTCTATATCTGTTCAGTATCATTCACTGGTTATCTCCATTTCTAAATATTCCTAACCCTTCCCCCACCCCGGTTCTGCTACTGAATGCCTCATGTCCATCTAGTCTGAGAAAGTGAGAGAAGGAATTATGCCAAGAACTAACCAGCAAAGCTCTTTCACTGGATGTAGACTATAGCCATGCCACCGTCCCTCCAGCTAGGCTTTGGCATGCTCCTCCATCCTTTTTTGTATGTCCTTTGCTTCCTACTTCTCTTTCACCCAATACACCATTCACTTAGTCTTTGTCTCTCTGCTTTTTATTAAGCTTCAGCCCCCTCTGTTCTATTTGGCACTCCAAGCTATGCCTGTTCAATGAATTTCTGACTTGGCAGGATAGTTTGGTGGTCTGAAGGATTTTAATCTACTGTTACTCTTGAATGGTCTCTGGGATGTTGCCTTTCCAGGAGCTTTTCGATAACAACACTGCTCTCAGAAGAATGAGACCATCTCTTGGTCCCTTGCACTCTGCTGTGTCATCAAAAGGCCGTGGGCTAGAGATGTTCTTCTTGAAAGGTGGTGGCCTTGTTGAGAGATGTAGAGCCAAGTCTTTTCGGTGGCTTGCCCAGATCGCTCTACCTCTGGCTTCTGATTCTCAACATACATACCTACATGGCTACTTTTAATAGTACAGTGTTGTTTTTTCAGAAAATAGCCACATGCTGGCAGGTTGGCTTAGTTTGGGGACACCAATACCACCAGAATGGCTGCCCTGACAGTATGCTTGGGGACTTTCTCGTGGCTTTTTGAACAAGAAGGCTGGGCACCCTAAAAGCCTCACGTATTCCCACCTCTGCAGCATGGTTTATACCTCAGTGTTATGTGCCCTGGAATGTTTCTCACTTCACATTTCTAGGTAGAAAGATTAGTGTTATGGAAGTGCCTAACTATCCCAGTCCAAAAGATTTAAAGATTGTCCTCAGTGTCTTGAAGTTTTGTACAAAATTCTCTATGAATTTTACATTTGGCAAATGTTAATGCTGGAAGCCATAGTCAGCCCTTAATACAGGTCCAAAGCATTGAATGTATTGTATCATTAGCTGCCTAGTTACACTGACTTCCTAGCTCCTCTCAGACCACTGCTAATCCCTTAGAAACGAGGGGTCTGGCATTGGTAGCATAACCTGAGGTGGCATTACAGGCCTTTGCACGAGCCAGAGCAACTTCTCTGCCTAAGTCAGCTAAATGTAGACCTCATTGAATCAGGCTGTTGTCCTAATGTTGGTCATTTATGAGTCTGTTCATTCTTATATCTGCCCTTAGCTGATTTTCTGACTCATTGCTTGCTGGCTTGTTTCCTTGCTTTGGAAGGCTATCCAAGATGTATACACAATACTTTCAGAAGGGAACTGCTAAAACAAAAAACACCACAAAGGGATTGGAAAGAGGGGAACAGAGCAGTAGTCAGGCTAGATAACTTAAGTATAAATGACTGAGGAATTCTTGATGAAGTATCAGTCTGACTTTGTGATCAAATGATATAATATAGGAATTGTGTAAAGGGAAGAATAATCTGACATTGATTTGTTAGAGAAGTACTTCAAAGGCTCCTTGACTTGCATATTTAAAATTCCTAAGATTATGGCTTTTTCTTCCCTTTGGCTGTATAGCAAACTGTTTTAATCCACAGTTGTGCCTTATCGTTCCATTAAAACTGTATTCTATCCATCAATAAACACTTGTGGTTAAAA