Transcript asmbl_53645

Sequence
Transcript Sequence for observation asmbl_53645 of TGE0006406:
CTTTTCTAACCTGGTGCAGCATCGTCCGCTAGGAGACGGGTGACGGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTGGGTTTCTAACCTTAAGAAAATGTTTTTCTGTTTCACTATCCTGGGGACTATTTCCAGATAGTGCTAATAACCCTCAGTATGTGGAGGACATTAATCAGAGTAGCATTTCAGCAGGCAGAGAAGAATCCTATGGGGTGACATTCCCTTCTCTTGTGGAGTGGCATGAGGAAGGTGTGTGGCCCCAGTTGTGGCTCTGCCAGCATCACTGGCCCTCTAAATGAAGTCAGAGGAGCTGCCAGTGTGGTATGACAGGACAGAGGCAGCTGGTTATTCACACCACGTGCAAGGGTTTGATCTTCTGCCATTTCTATATTTGGCACCTCTGAGCCTTCAAAAGTGAACCATTCTCTTCTTTTGCATAAGTTGCCTTATTATTCAGTCACAAGAGAGGAGTGACATGGTTCTACAGATGTCGCATTCCTTCAATCTCTTGTTGAGCTTTAGCGTGTGGGCACTGCGCTTGCCTTCTAGAGGCTCCCAGTCCAATAGAGGAGAGATAGAAACAGATTTGTTTTAATGCAAAGATACTGTAATGGACATATCTACAAGGAGCTCAAGCAGCATGAAATAGGGAGGAATTGGACTTCTCTGCATCTTTGGATGAAATCAGATGTAGAAAATCCAGCTTTTTCATGAAATTCTGCTCTGCAGGGAACCTTAGTCCTAAAAACCTGTTCAAATTTCCTGTTATATTCAAGGATAGGAAAATTAATTCGAGAGAGCATCAGAGAATTTGGCTGACCTTCCCAGAATCACAGTTACTAAATGGTAGAGCCAGGATCTCAACTTGAATACCAGCATTCTTTCCTCTAAGGTTATAGGAGAATCAGTGGAATAAACTAATGGGACATGCTCTTTGTAATGGATTTGGAAAATTGTCTGCAGCTACTTCTTTTATGAATGGTGATGTACACAGAACTTAGATAAGTTGGGTGGAACAATCTGTAATCCAAATTATAAGTATATTTGTTAACAAGACGTTTTTTCTTTCTTTTTTTTTTCAGGTTTGAAGATGCCTCATTTAA