Transcript asmbl_53644

Sequence
Transcript Sequence for observation asmbl_53644 of TGE0006406:
CTTTTCTAACCTGGTGCAGCATCGTCCGCTAGGAGACGGGTGACGGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTTTGAAGATGCCTCATTTAAATTGGACTAATTCCAAATTGTTTCTTCTTTTTTTTTTAAATACTTATA