Transcript asmbl_53631

Sequence
Transcript Sequence for observation asmbl_53631 of TGE0006402:
CCGGAAGAAAGGACTCCTGCTGCAGATGTCTTGTGATTACCTCGGAAGCCTTACTTCGCCAGTTGAAACTGCAGAAGAAAATAGGATCTAGCGAAATATGGCTACGGAGGGCCCTGCCACGTGTCGAATCCAGGTGGCAGAACATCCCAGATTGCTAAAGCTAAAAGAGACATTTAACTCTAAGTTTGGATCCATTCCCAAGTTTTATGTTCGAGCACCAGGAAGAGTCAACATAATAGGAGAACATATAGATTACTGTGGATATTCTGTTCTTCCTATGGCTGTGGAACAAGATATGTTAATAGCTGTGGAACCTGTGAAAACACACACTCTTCAACTGGCCAATACAAATCCCTTGTACCCAGATTTCAGTACTAGTGCTAATAACATTCAGATTGACAAAACCAAGCCTCTGTGGCACAACTATTTCCTATGTGGATTTAAAGGAATTCAGGAACACTTTGGTCTTAGTAACCTGACTGGAATGAATTGCTTGGTGGATGGAACCATCCCACCAAGTTCTGGCCTCTCCAGCTCCAGTGCTTTGGTCTGTTGTGCTGGCTTGGTGACGCTCACAGTTTTGGGAATGAACCTATCCAAGGTGGAACTTGCAGAAATCTGCGCCAAGAGTGAGCGTTATATTGGCACCGAAGGAGGAGGGATGGACCAGTCCATATCATTTCTTGCAGAAGAAGGAACGGCCAAGTTGATAGAATTTAGTCCTCTGAGGGCAACGGATGTGAAACTCCCAAGTGAAGCAGTGTTTGTGATTGCCAACAGTTGTGTGGAAATGAATAAGGCAGCAACTTCCCATTTCAACATCAGGGTGATGGAGTGCCGGCTGGCTGCAAAGCTCCTGGCTAAGTACAAAAGCTTGCAATGGGATAAAGTACTGCGGCTGGAGGAGGTACAGGCCAAACTAGGGGTCAGCCTGGAAGAAATGCTGTTAATCACAGAGGATGCTCTTCACCCTGAACCCTATAGCCCCGAAGAGGTCTGCAAGTGTCTGGGAATTAGCCTGCAGGAACTCCGGACCCAAATCCTGAGTCCGAACACACAAGATGTGCTCATCTTCAAACTCTACCAGCGGGCAAAGCACGTGTACAGTGAGGCTGCGCGAGTACTCCAATTTAAGAGGATATGTGAAGAGGCACCTGGCAACATGGTCCAGCTGCTGGGGGAGCTAATGAACCAGAGCCATGTGAGCTGCCGGGACATGTACGAGTGTAGCTGCCCTGAGCTGGACCAGCTG