Transcript asmbl_53526

Sequence
Transcript Sequence for observation asmbl_53526 of TGE0006378:
CGCGAGCTCACCTGGGCTCGCAGCCGTGCGGCGGGGCTTGACGGAGCAAAGCGTCTCAGCCGTAGCTTCCAGTTTCGTGCGGCTCGTTTCTGCGACCCGCTGTCCTCGCCAGCCCTTCCAGCGAGCTTGGCGTCCCGCGCGCGCGTCTAGGCATCACGGAGCCTGCTGCCATGAAGCCAGCGAGGACTAAGACACCCAGGAAACCTGTAGTGAAAAAAGGATCCCAAACAAGTCTTAAAGACCCAGTTGGGGTATACTGTAGGGTGCGCCCACTGAGCTTTCCTGATCACGAGTGTTGCATAGAAGTGATCAATAATACAACTGTTCAGCTTCATACTCCTGAGGGTTACAGACTCAACCGAAATGGAGACTATAAGGAGACTCAGTATTCATTTAAACAAGTATTTGGCACTCATACTACCCAGAAGGAGCTCTTCGATGTTGTGGCTAATCCCTTGGTAGATGACCTTATTCATGGCAAGAATGGTCTCCTTTTTACATATGGTGTGACGGGAAGTGGGAAAACTCACACCATGACTGGTTCTCCAGGGGAAGGAGGGCTACTTCCTCGTTGTTTGGGCATGATCTTTAACAGTATCGGGTCATTTCAAGCTAAACGATATGTTTTTAAGTGTAATGATAGGAATAGCATGGATATACAGTGTGAAGTTGATGCCTTATTAGAACGGCAGAAAAGAGAAGCCATGCCGCATCCAAAGACCCCTGCTATCAAACGACAAGCAGACCCAGAGTTTGCAGATATGATAAATTTACAAGAATTTTGCAAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTGAAATATATAATAATTACATATATGATCTATTGGAAGAAGTTTCGTTTGATCCCATAAAGCCAAAGTGGAACAGTTGCAGCACGCCCATGAGGAACACAGACTTTGTACCTCCGCAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATGTATGTTGCAGGATGTACAGAAGTAGAAGTAAAATCTGTTGAGGAGGCTTTTGAAGTTTTCTGGAGAGGCCAGAAAAAGAGACGTATTGCTAACACACATTTGAATCGTGAGTCTAGCCGTTCTCATAGCGTGTTCAACATTAAATTAGTTCAAGCTCCACTGGATGCAGATGGGGATAATGTCTTACAGGAAAAAGAACAAATCACTATAAGCCAATTGTCCTTGGTAGATCTTGCTGGAAGTGAAAGAACTAACCGGACAAAAGCAGAAGGGAACAGATTACGTGAAGCTGGTAACATTAACCAGTCACTAATGACACTAAGAACATGTATGGAAGTCCTGAGAGAGAACCAAATGTATGGAACTAACAAGATGGTTCCATATCGCGATTCAAAGTTAACTCATCTATTTAAGAACTACTTTGATGGAGAAGGAAAAGTACGCATGATTGTGTGTGTGAATCCAAAGGCCGAAGATTATGAAGAAAGCTTGCAAGTCATGAGATTTGCGGAAGTGACCCAAGAAGTTGAAGTAGCAAGACCTGTAGACAAGGCAATATGTGGTTTAACGCCTGGACGGCGATTCAGGAATCATGCTCGGGCAGGTCCAGTTGAACTACTGGTTACAGAAGTGGTTTTACAGAGTTTTCCACCTTTGCCATCCTGTGAAATTTTGGATATCAATGATGAGCAGACTCTCCCGAGGCTGATTGAAGCTTTAGAGAAACGCCATCAACTACGACAAATGATGACTGATGAGTTTAACAAACAATCTGTTACTTTTAAAGCTATGTTGCAAGAATTTGACAATGGTGTTTTAAATAAAGAAAACTACATTCAAGGAAAACTAAATGAAAAAGAAAAGGTGATCTCAGGACAGAAATTGGAAATAGAACGACTGGAGAAGAAAAACAAAACTTTAGAATATAAGATTGAAATTTTAGAGAAAACAACTACTATCTATGAAGAAGATAAGCGCAATCTGCAGCAGGAACTTGAAACCCAGAATCAGAAACTTCAGCGACAGTTTTCTGACAAACGCAGACTAGAAGCCAGGTTACAAGGCATGGTGACAGAAACAACAATGAAATGGGAGAAAGAATGCGAGCGTCGAGTGGCAGCTAAACAGCTGGAGATGCAAAATAAACTCTGGGTGAAAGATGAAAAACTGAAACAACTAAAGGCTATTGTTACTGAACCCAAAACTGAAAAGCCAGAGAGACCCTCTCGGGCACGAGATCAAGAAAAAGCTCCTCAAAGATCTGTTTCTCCATCGCCAGTACCCCTTTCTAGTAACTATATTGCTCAGATTTCCAACGGCCAGCAACTCATGAGCCAGCCACAACTACATAGGCGCTCTAACTCTTGCAGCAGCATTTCTGTAGCTTCCTGTATTTCGGAGTGGGAGCAGAAAATTCCTCCGTACAACACACCTCTCAATGTCACATCCATTGCAAGGCGTAGGCAGCAGGAGCCAGGACAAAGTAAAACTTGTATCGTGTCAGACAGAAGGCGAGGGATGTACTGGACTGAAGGCAGGGAGGTGGTTCCTACATTCAGAAATGAGATAGAAATAGAAGAGGATCATTGCTGCAGGAATGTACCACCACTTCGTCTCCGACACAGACGATCACGCTCTGCAGGAGACAGATGGGTAGATCATAAGCCTGCCTCTAACGTGCAAACTGAAACAGTCATGCAGCCACATGTCCCTCATGCCATCACAGTATCTGTTGCAAATGAAAAGGCACTAGCTAAGTGTGAGAAGTACATGCTGACCCACCAGGAACTAGCCTCCGATGGGGAGATTGAAACTAAACTAATTAAGGGTGACGTTTATAAAACAAGGGGTGGTGGACAATCTGTTCAGTTTACTGATATTGAGACTTTGAAGCAAGAATCACCAACTGGTCGAAAACGGAGATCTTCCACAGTAACACCTGCCCAACCAGATGGTGCAGAGTCTGAATGGACCGATGTAGAAACAAGGTGTTCTGTGGCTGTAGAGATGAGAGCAGGGTCTCAACTGGGTCCTGGATATCAGCATCACGCACAACCCAAGCGCAAGAAGCCATGAACTGACAGTCTAATTAATGAAAGAACATTTTGTGTCAGTAATTTCTTCAAGACCATGCCAGAAGGAGTCTTCTGAGTCATCTTGTAGAAGTCCAACTTTGACTATCACAGACCTCAGATACATCATACACTGGCCTAGATCAGAGATTTCTGTCTGGTTCCAAAGACATCTAGGATTCAACAAACTTTTTATATCCCTTGCCATATTTAATATTAATAGAGAAAGACCCCCCTTTTCTCATTGCTGCATGAACTTTTTAATAATGCTATTTTTGTATATTTGTATACTTATAAACTAATTCATGCAAGTGTTTGTCTTGGGTGATTAAGGAAGAATATATCTAGATCACGCTTTATTTTTTATTGTGACTTTTCCAGCTCTTGTCTGAATATTAAGGTTTTATAAACAAAACAAATGCTGCTATTGATTAGCTGCAAGAATGCACTTTAGACATATTTGACAATTCAAACTTTCAAAATAAAGATGTCAATGACTGGCCAATACTAAAACCATTTTAAGAAGTCGTTTTGAATTTTGTATGTATATATTCACTTTCTGACACTTAGATATACCAAAAGAATTGAAATAAAAAGCACTAAGAAATACAAA