Transcript asmbl_53479

Sequence
Transcript Sequence for observation asmbl_53479 of TGE0006369:
GAGAGAGCCTATTACTAGTTTGCGTGCTGTGGTGTAGGGGGTGCGCTTAAGGCCCTGAAGCGCTACGCGTTCTGCTGGTTTTATCAGCATGAGCTCAATCGGTACCGGGTATGACCTGTCAGCTTCCACATTCTCTCCTGATGGAAGAGTTTTTCAAGTTGAGTATGCGATGAAAGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGTAAAGACGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAACGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGCTGGCAGATGCTCGTTCTTTAGCTGACATTGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTATAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTACATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGATCTTACAGTGTGAATGACGGTGCACAACTCTACATGATTGACCCATCAGGTGTTTCATATGGTTATTGGGGCTGTGCTATCGGCAAAGCCAGGCAAGCTGCAAAGACAGAAATAGAAAAGCTTCAGATGAAAGAAATGACCTGCCGTGATGTTGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTAAGGATAAAGCTTTTGAACTAGAGCTCAGCTGGGTTGGAGAAATAACTAAAGGAAGACATGAAATTGTTCCAAAAGATATAAGGGAAGAAGCTGAAAAATACGCTAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGATGACAATATGTAACACTTCTGCAGCTGTTTTAAATTTCTATTATAGTTCCCATGTAACTATTTAGCCCTGTGGATTATTACATACCTACTGACCAATTTTCATTAAAATTTTGTCTTGTAATGA