Transcript asmbl_51517

Sequence
Transcript Sequence for observation asmbl_51517 of TGE0000988:
CTTCGAGTGTGGAATCCTCTGGTTATCGTCGCCATCCTGGTCTCGGGGGCACCGATCTCAGGGTCTTCGGGAGGAGAATTCTTGCCGTTACTGATTTCTCGCTGAAGGCAGTGTCCTATGCAAGGGGACGTTAGGAGCACCCGATTTGGCGCCCTGGGGCCTTGCGGCCTTTGCCGCCCGAAGAGGGGCGCGATGAGCGGGAATGGGGGCTTCAGGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAAGCAGAATGTCGATTGTCTTTATTAGTAAATATACTTCAGGTCTCCGTGCAAGATGGATCAAACGTGTTTTCTTCTGATTAGAAATAGA