Transcript asmbl_51284

Sequence
Transcript Sequence for observation asmbl_51284 of TGE0006270:
GCGCTCGGAGCCTGCAACTCTCGCGAGAGAAGCGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAAAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACAGACTTTACCACCTGAAACTGCTGCTTCAAGTTCAGATCAGGCAAGGAACAAACCTCGAAACAACCAACAAGACCAAAGAAGAGTACACTTTAAATTGAAGACACAACACTTGATCTGAAACAAGAAGTTTGTGCCTACTCAACAGCTTTGAAAGAGCACTTCCCAACGCTGCTAGTAGTCTTTGTTTTCTTCAGTGCTGTACTGTGAGATTGCCCGGTGCAGCAGCAGTTGTATTCTTTATTAGCCTGATAGATCATTTTCTCTCGCTCTTTTTTTTAATACTAGCAACTTTCATCCTTTGAAACGTGTGCTGAAAAAGAAGAATCAGCAAATACTACTGAAAGTGCAATATTTGATTATCACTGCGAGATGAGCTTTGATCCAAACCTTCTCCACAACAATGGACACAACGGGTACCCTAATGGTACTTCAGCAGCACTGCGTGAAACTGGGGTTATTGAAAAACTGCTAACCTCTTACGGATTTATTCAGTGTTCAGAACGTCAAGCTAGACTTTTCTTCCACTGTTCACAGTATAATGGCAACCTGCAGGACTTAAAAGTAGGAGATGATGTTGAATTTGAAGTATCATCTGACCGGCGGACTGGGAAACCCATTGCTATTAAACTGGTGAAGATAAAACCAGAAATCCTCCCTGAAGAACGAATGAATGGACAAGTTGTGTGCGCTGTTCCTCACAACTTAGAGAGTAAATCTCCAGCTGCCCCGGGTCAGAGTCCAACAGGGAGTGTATGCTACGAACGTAATGGGGAAGTGTTTTATCTGACTTACACCCCTGAAGATGTGGAAGGGAATGTTCAGCTGGAAACCGGAGATAAAATTAACTTTGTAATTGATAACAATAAACATACTGGTGCTGTGAGTGCTCGAAACATTATGCTGTTGAAAAAGAAACAAGCCCGCTGTCAGGGAGTAGTTTGTGCCATGAAGGAGGCGTTTGGCTTTATTGAAAGAGGTGATATTGTAAAAGAGATATTCTTTCACTATAGTGAATTTAAGGATGACTTAGAAACCTTACAGCCTGGAGATGACGTGGAATTCACAATCAAGGACAGAAATGGTAAAGAAGTTGCAACAGATGTCAGACTATTGCCTCAAGGAACAGTCATCTTTGAAGATATCAGCATTGAACATTTCGAAGGAACTGTAACCAAAGTTATCCCAAAAGTACCCAGTAAAAACCAGAGTGACCCATTGCCAGGACGCATCAAAGTTGACTTTGTGATTCCTAAAGAACTTCCCTTTGGAGACAAAGATACAAAATCCAAGGTGACCCTTTTGGAAGGTGACCATGTTAGGTTTAATATTTCAACAGACCGACGCGACAAATTAGAACGAGCAACCAACATAGAAGTTCTATCAAACACGTTTCAGTTCACTAATGAAGCCAGAGAAATGGGTGTAATTGCTGCCATGAGAGATGGTTTTGGTTTCATCAAGTGTGTGGATCGTGATGCTCGTATGTTCTTCCACTATAGTGAAGTTCTGGATGGGAACCAGCTCCATATTGCAGATGAAGTAGAGTTCACTGTGGTTCCTGATATGCTCTCTGCCCAAAGAAATCATGCTATTAGGATTAAAAAGCTTCCCAAGGGCACGGTTTCATTCCATTCTCATTCAGATCATCGTTTTCTGGGCACTGTAGAAAAAGAAGCCACTTTTTCCAATCCTAAAACCACTAGCCCAAATAAAGGCAAAGAAAAGGAGGCTGAGGATGGTATTATTGTTTATGATGATTGTGGAGTGAAATTGACTATTGCTTTTCAAGCCAAGGATGTGGAAGGATCTACTTCTCCTCAAATAGGAGATAAGGTTGAATTCAGTATTAGTGACAAACAGAGGCCTGGACAGCAGATTGCAACTTGTGTGCGACTTTTAGGTCGTAATTCTAACTCCAAGAGGCTCTTGGGTTATGTGGCGACTCTGAAGGATAATTTTGGATTTATTGAAACAGCTAATCATGATAAGGAAATCTTTTTCCATTACAGTGAGTTCTCTGGTGATGTCGATAGTCTGGAACTGGGGGACATGGTCGAGTACAGCTTGTCCAAAGGCAAAGGCAACAAAGTCAGTGCAGAAAAAGTCAACAAAACGCACTCGGTGAATGGCATTACTGAAGAAGCTGATCCTACCATCTACTCTGGTAAAGTCATTCGCCCCTTGAGGAGTGTTGATCCGACACAGACTGAGTACCAAGGAATGATTGAGATCGTGGAGGAAGGGGATATGAAAGGTGAGGTCTATCCATTTGGCATAGTTGGAATGGCCAACAAAGGGGATTGCCTACAGAAAGGGGAGAGTGTCAAGTTCCAATTGTGTGTCCTGGGCCAGAATGCACAGACTATGGCCTACAATATCACACCCCTACGTAGGGCCACAGTGGAATGTGTGAAAGATCAGTTTGGCTTCATTAACTATGAAGTAGGAGATAGCAAGAAGCTCTTTTTCCATGTGAAAGAAGTTCAGGATGGCATTGAGCTACAGGCCGGAGATGAGGTGGAATTCTCAGTGATTCTTAATCAGCGCACTGGCAAGTGCAGTGCTTGTAATGTTTGGCGAGTCTGCGAAGGCCCCAAGGCTGTTGCAGCTCCACGACCTGATAGGTTGGTCAATCGCTTGAAGAACATAACCCTGGATGATGCCAGTGCTCCTCGCCTAATGGTTCTTCGTCAGCCAAGGGGACCAGATAACTCAATGGGATTTGGTGCAGAAAGAAAGATCCGTCAGGCTGGTGTCATTGACTAACCACATCCACAAAGCACATCATTAATCCATTATGATCAAGTTGGGGGGATTCTGGTGAAGGGTTCTGAATATCTCCCTCTTCATCCCTCCCAAAATCTGGAATACTTATTCTATTGAGCTATTACACCAGTTTTAACACCTTCCTCGTGTTATGTTTAAAAAAAATAAATAAATTTAAGAAAACCATTTTAAAATTATGCACAGTTGCAGCCTGGAAAACTTAAGGTGGCGCCTTATAGTATCAATTTTAGAAGCTTTATTTGGTGCATTTAACGCAACTGGTAATTGCAAAATCCACTTCCCCTGTGTAAGTGAAAAGTATAGACTGTTATCTTGTTGGCCCTATGAAATTCTGCACTTGATATTCAGTATATACTCTACCTTCATTACTTCTGGCAAGGTGTTCGGCCTTAGCACTCAGTTGCATTCTTTCCTGTTCATTATGCTTTAATTCTGAGGACCATATGAGGGTAGAATATATTAAAAATTACAAAAATTTGTATAGGCGAACCATTTCCTTAAGTTGGTGGCCAAATGTTAAAATGTTATTTTTCATATCATTTATAATCTTGTCACAGTCCACTTAACAAAGTTTGGTTAGATTTCAATGAAAATTATCTTCCAGAGTAGTTTTTTTTTCCTGGGATGGGAGGGGGGTAAACTTTACTACAAATAGTATGTATGGTGCAGAATTTCATGCAAATGAGATGTGCCAGCAGTGTGATAATTTAAACGTATTTAAACAGAAACAACAAAAAAGGACAAATGCACAAACTCGCTGCTGCTTAGATCACTGCAGCTTCTAGGACCCAGTTTCTTTTACTGATTTCAAAACAAAACAAAAAAATAAAAAAGTTGTGCCTGAAATGAATCTTGTTTTTTTTATAAGTAGCCGCCTGGTTCCTGTGTCCTGTAAAATACAGGCACTTGACCCTTGGTGTAGCTTCTGTTCGACTTTATATCACGGGATTGGATTGGTCTGATTTCTTGGCCCTCATCTTGAATTGGCCACATACAGGACAGGGTCCCTGGCCAGTGGACTGAAGGTTTTGTCCACAAGATGACAAAAGGTCAGCTCAGGGGATGTGTGGGAGGGCACTTTTATCTTCCCCATTGTCATTTGAGTTTTTGATCTCTGGGTAAAGAGGCCGTTTATCTTTGTAAACACAAAACATTTTTGCTTTCTCCGGTTTTCTGTTAATGGCGAAAGAATGGAAGCGAATAAAGTTTTACTGATTTTTGAGACACTA