Transcript asmbl_50360

Sequence
Transcript Sequence for observation asmbl_50360 of TGE0030733:
CCGCTGCCGCCGCCGCCGCCGCCGCGATGCCCCGTAAGTTCAGCTGCCGGCAGCTCCGGGAGACAGGCCAGCGCTTCGAGAATTTCCTGGTGGAGAAGGGACTGGACACGGAAACAGACCGCGAGAAGCTGCGAACCCTTTATAACCAAGACTTCAAGATCAGCTCTGGGACCCCCAACCCTGGCTTCTCCTCCATGCTGTACGGGATGAAGATTGCAAATCTGGCCTTCGTCACCAAGACTCAGGTCAGGTTCTTCAAACTCGACTGCTGGGCCGACGTGTCATTGCCAGAGAAGAGGAAAATGAGGCTGGGGTCCGATATCAGCACACACCACAAGTCACTGCTAGCCAAGATCTATCACGACAGGGCTGAGTATCTTCACGGAAAACATGGTGTGGACGTGGAAGTCCAGGGGCCCCATGAAGCCCGGGATGGGCAGCTCCTTATTCGCCTGGATTTGAACCGCAAGGAGGTGCTGACCCTGAGGCTTCGCAATGGAGGAACGGAGACTGTCACCCTCACCCATCTCTTCCCACTCTGCCGGACCCCCCAGTTTGCCTTCTACGATGAAAAACAGGAGCTGCCCTGTCCACTGGGCCCTGGTGAGAGCTACGACCTCCACGTCCACTGTCGGACCACTTTTGTGGGCTACTTCCCAGCCACGGTGCTCTGGGAGCTGCTGGGACCTGGGGAGCCCAGTTCCGAAGAAACTGGCACTTTCTACATTACCCGCTTCTTGGCGGCCGTCGCCCACAGTCCTCTGGCAGCACAGCTGAAGCCCACGAAGCCATACAAGCGGATCCCGATCACTGGAAAGCCTGTAGTGACCACCCGGATAGAGGAAGGAGAGAGACCTGACTGTACGAAGGGCTATGACCTGGAGCTAAGTATGAAGTTGGAGATGTATAACCCACCCCCCAGCCTCCGGCAGCTGCTCCCCAAACTTCAGGGAACAAGCGTCTTCACTGCCCCAAAGGACATTGCTAAAATCAAGGCCCAGCTGGAGACAGCCCTAAAGTCGAGGAACTACGAGGTGAAGTTCCGGCTGCTGCTGCATCTGGAAGAGCTGCAGATGGAGCATGACATCCGGCACTATGACCTGGAGTCGGTGCCCATGACCTGGGACCCCAAAGACCAGAACCCCAGGCTGCTCACGCTGGAGGTTCCCGGGGTGGCAGAGAGCCGCCCCTCAGTGCTCCGGGGAGACCACCTGTTTGCCTTGTTGTCCTCTGAGACAC