Transcript asmbl_50329

Sequence
Transcript Sequence for observation asmbl_50329 of TGE0006216:
CGATGCCTGACGCGATGCCGCTGCCCGGGGTCGGGGAGGAGCTGAAGCAGGCCAAGGAGATTGAGGACGCCGAGAAGTACTCCTTCATGGCCACCGTCACCAAGGCGCCCAAGAAGCAAATCCAGTTTGCTGATGACATGCAGGAGTTCTCCAAATTCCCCACCAAGACTGGTCGAAGATCTTTGTCTCGCTCCATCTCTCAGTCCTCCACTGACAGCTACAGTTCGGCTGCGTCCTATACAGATAGCTCTGATGATGAGGTTTCCCCCCGAGAGAAGCAGCAAACCAACTCCAAGGGCAGCAGCAATTTCTGCGTGAAGAACATCAAGCAGGCAGAATTTGGACGCCGGGAGATTGAGATTGCAGAGCAAGACATGTCTGCTCTGATTTCACTCAGGAAACGTGCTCAGGGGGAGAAGCCCTTGGCTGGTGCTAAAATAGTGGGCTGTACACACATCACAGCCCAGACAGCGGTGTTGATCGAGACTCTCTGCGCCCTGGGGGCTCAGTGCCGCTGGTCTGCATGCAACATCTACTCCACTCAGAATGAAGTGGCTGCAGCACTGGCCGAAGCTGGAGTCGCAGTGTTCGCGTGGAAGGGCGAGTCGGAAGATGACTTCTGGTGGTGCATTGACCGCTGTGTGAACATGGATGGGTGGCAAGCCAACATGATCCTGGATGATGGGGGAGACTTAACCCACTGGGTTTATAAGAAGTATCCAAACGTGTTTAAGAAGATCCGAGGCATTGTGGAAGAGAGCGTGACTGGTGTTCACAGGCTGTATCAGCTCTCCAAAGCTGGGAAGCTCTGTGTTCCAGCCATGAACGTCAATGATTCTGTTACCAAACAGAAGTTTGACAACTTGTACTGCTGCCGAGAATCCATCTTGGATGGCCTGAAGAGGACCACAGATGTGATGTTTGGTGGGAAACAAGTGGTGGTGTGTGGCTATGGTGAGGTGGGAAAGGGCTGCTGTGCTGCTCTCAAGGCCCTCGGAGCAATCGTCTACATCACAGAAATCGACCCCATCTGCGCCCTGCAGGCCTGCATGGATGGGTTCAGGGTGGTGAAGCTAAATGAAGTCATCCGGCAAGTCGATGTTGTGATAACTTGCACAGGGAATAAGAATGTAGTGACACGGGAGCATCTGGACCGCATGAAAAACAGTTGTATCGTATGCAATATGGGCCACTCCAATACGGAAATCGATGTGACCAGCCTCCGCACTCCGGAGCTGACGTGGGAACGAGTCCGTTCGCAGGTGGACCATGTCATCTGGCCAGATGGCAAGCGCGTCGTCCTCCTAGCAGAGGGTCGTCTGCTCAATCTGAGCTGCTCCACAGTTCCCACCTTTGTTCTGTCCATCACAGCAACCACACAGGCTTTGGCACTGATAGAACTCTATAATGCACCAGAGGGACGATACAAACAAGACGTATATTTGCTTCCTAAGAAAATGGATGAGTACGTTGCCAGCTTGCACCTGCCATCATTTGATGCCCACCTGACAGAGCTGACAGATGACCAAGCAAAATATCTGGGACTCAACAAAAATGGGCCGTTCAAACCCAATTATTACAGATACTAATGGACCACATTGCCAGGGACCAGTCCACATGAACCACACAACTCTAAAAGAAATATTTTTTAAGATAACTTTTATTTTCTTCTTATTCTTTTCCTCTTGATTTTTTTTTCTATAATTTCATTCTTGTTTTTTCATCTCATTATCTAAGTTCTGCAGACCACACAGGAACTTGCCTCATGGCTCTTTAGATGAAACAGATTCAAGGTTTCTCACCCTAGTCACTAAAGAAGGATTCTCTTCCAGCCCAGAAAGGTGATTCTTTCTTTACCATTTCTGGGGACTTTAGTCTTAAGTGGGTACCTTATTAACAGGAAATGCTAAGGTACCTTCTATGTGGAACAATCTGCAATGTCTAAATTGCCTTAAAAGAGCCCATTTCCTAGCTGCTGAAATCAGTGCTCTTTGATTTCTTCAGAGGAGCAGGGATAGTACCTACCAGCCAGGTAGGTTAGATGTAGGTGGTGCATGTTAATTCCCCCTCGATGTTCCAAGCCCTGTTTCCTGTGTGAAGATGGTTTGTCTGGTTCAGAGATGTGTACTAGTGAGTGTTGCTTGTTAAGATCCGGTAGGGTTTAGTACAGTTCTTCTTCCACTCCACCCAGACCTTCTCTTTTTTCAGGTTTTTAACCAGATTGCACTCTATTAAGTTGAATTTGGCTCCTAGCATTTATATCTGTTA