Transcript asmbl_50055

Sequence
Transcript Sequence for observation asmbl_50055 of TGE0006193:
TGCGCCTGCGCACGAGCTGGGGCCTTTTTTCCCCCCGGAGCTGTGCTTGGCCTGTAGGTCTGTGACGAGCCGCGAACGCGGGTCTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTCAAGAATAAGGCCTACTTCAAGAGATACCAAGTGAAATTCAGAAGACGACGAGAGGGTAAAACTGATTACTATGCCCGAAAACGTTTGGTAATCCAGGATAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTCGTGTAACCAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAAGGAGATATGATAGTTTGTGCAGCTTATGCTCATGAACTTCCAAAGTACGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGATTTGGCATGGACAAAATCTATGAAGGCCAAGTGGAGGTGACCGGAGATGAATACAATGTGGAAAGCATTGATGGTCAACCTGGTGCCTTTACCTGCTATTTGGATGCAGGGCTTGCAAGAACTACTACTGGAAATAAAGTTTTTGGGGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATTCCTCACAGTACCAAACGATTCCCTGGCTATGATTCAGAAAGCAAGGAATTCAATGCAGAAGTACATCGGAAGCACATCATGGGTCAGAACGTTGCAGATTACATGCGTTACCTAATGGAAGAAGATGAAGACGCTTATAAGAAACAGTTCTCTCAATACATAAAGAACAACGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAGAAGAAGCCTAAGAAGGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAACGGGCTGCTGAGAGCTAATAAACCAAACTGAAATTTTCTATTAAGATTTTTCATATAAAGATAGTAATAAACTTATTGAATCTGCA