Transcript asmbl_50007

Sequence
Transcript Sequence for observation asmbl_50007 of TGE0006181:
GTATGTATGGTTTTATGTTAAAAGCTTATTTTAAAGAAGTCAGACCATTCGGCATCATCGGTAGGTCAGTATTTATGGCCCGTGTTTTTTAATAATATCCAACTCAGTGCATGCCAAGGACTGATGATAGGTCCTTGAAATGCTGTGAAGTACACCTTTGGATATGTGAGGTTGCAGGAACATAAATATTTTAACACCGGTTCTTCCCAGTACTCTTTTAGAGGTCTTGGCAGACAGATTCCTTTCTTGTCTAGATTTGTAAGAGGTTTAAGGTGCAGAATAAGTTTCTCCTTTTGGAGTTGAGGTAAACTTTCAAGGTCAATGATGTGTTGGCATGTATTACCTGAATTTATGGCTGATGTGTAATAACACGAGCTCTAGAATTACGCTGAGACCTTGAAAAACTTACTTGGTTTCCTTTCTGGGACAATCTTAGAAAATTAGTGAATGAGTCAACTGAAAAGTATTTTTCCCTGGAGTATCCAAACAACTGGATTATATATACCATCTTGGAAAACATCGTTGATAAGTTCTTAAGTGTTTGGTTCCCATAACTTTGTAGTTACGGAGTTGTTAGGGCAATGTTTATTTTTTATCTACTGCTCACTTGATTTCTTTAAAACTGAGTTTTGGGTTCACAGCAAACCACTAAGACCACTCACTGATTCAAAACCTTAAAATATAAAGCATTGGTGACCATAGCAAAAATTTGTTTCTGGAATCTTCGTGCCAGTTTTTTTTTGATTTGTTTTAATGGCTCCATTATTAGCCACTCTTACCCATTTTATCTTTTGTATGTATTGGCCATTTTGGTTTGCAAGTAGTTAAATCATTTACTGATAAAAAGGTTTCATAAAGAGTATATGTTAAAAGAATGTCTAATAAGTACATTTCTTAAATGTTTTCCTCGAACTTGTGAAAGGTCTTTTTCTGACTTACGTTTGGCTTTTGGAAGAGATTAAAGCTGTATTTGTATTGTCAGTAAATTGAGTTTATCATGCTTTTCAAGATAGTAGTCCCCTCATGCCCCAAATTTGAAAGCCACAAGTTTAAACTTATTGATGATGGATTAAGTGAAGTAAAAAGTAACTGGCTAGCTTTCTGTGTTCAATCTCTACCCCCGCATCAATTCAAACGGCACATTAATTGTGTATTTTAGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAACCTGTGTCATTTTAAGAGTAGTGTTACACAAGTAATGGTTCACTCAACATTGTTGACCAATAATACATGGTTAAACACCTTGAACGTAGGTGCTTGCATGAAATTCACTAGAGTTTTGACTAAATTGCAGTTTATGAGTTTGGAAGTCTTTGGATGAAACTTAAAATGGTGTCAGAAGTATTTGAAGTTTTGCAAAATGCAGTCATTGCTTGTGGGTGAACTATGTTGTTAAATACCTG