Transcript asmbl_25924

Sequence
Transcript Sequence for observation asmbl_25924 of TGE0004506:
CCGTCACTGTGAGCTGGAGAAACTGCGGCAAGACTTTGACGAGGTCACTACGCAGAATGAAAAGCTGAAGGTGGAGTTGCGGAGCGCAGTGGAAGAAGTGGTTAAGGAGACCCCGGAATACCGCTGCATGCAGTCACAGTTCTCCGTACTGTACAATGAGAGCTTACAGTTGAAAGCACATTTGGATGAGGCTCGGACCCTGCTCCATGGCACCAGGGGGACCCACCAGCGTCAAGTCGAGCTCATTGAGCGAGATGAGGTTAGTCTTCATAAGAAGCTGAGGACCGAAGTGATCCAGCTAGAAGATACACTGGCCCAGGTCCGCAAGGAATATGAAATGCTGAGGATAGAATTTGAACAGACCCTTGCCGCCAATGAACAAGCAGGCCCCATAAACCGGGAGATGCGCCACCTCATCAGTAGCCTCCAGAATCACAATCACCAGCTGAAAGGGGAGGTCCTAAGGTATAAGCGGAAGTTACGAGAAGCCCAGTCTGACCTGAACAAGACACGTCTGCGCAGTGGCAGTGCCCTCCTGCAGTCTCAGTCCAGCACTGAGGACGCTAAGGATGAGCCTGCAGAGGTGAAACAAGATCTCGAGGACTTACCTGCCCAGTCCTCTGCACCGAAGGCACCTCAGGAGGAAGCCAACGAAATGAAGTCCAAACGGGATGAGGAAGAGCGAGAACGAGAAAGGAGGGAGAAAGAGAGGGAGCGAGAAAGAGAGCGAGAGAAGGAAAAGGAGAGAGAACGAGAGAAGCAAAAACTAAAAGAGTCAGAAAAAGAGAGAGATTCTGCTAAGGATAAAGAGAAAGGGAAACATGATGATGGAAGGAAAAAGGAAGCAGAAATTATCAAACAATTGAAGATTGAACTCAAGAAGGCACAGGAGAGCCAAAAGGAGATGAAACTACTGCTAGATATGTACCGCTCTGCCCCAAAGGAACAGAGGGACAAAGTTCAGCTAATGGCAGCTGAGAAGAAGTCCAAGGCAGAGTTGGAAGATCTAAGGCAAAGACTCAAGGATCTAGAGGATAAGGAGAAAAAAGAGAACAAGAAAATGGCTGACGAAGATGCTTTGAGGAAGATCCGGGCAGTAGAAGAGCAGATAGAATATCTGCAGAAGAAGCTGGCCATGGCCAAGCAGGAAGAAGAAGCTCTCCTCTCTGAGATGGATGTCACGGGCCAGGCCTTTGAAGACATGCAGGAGCAAAATATCCGTTTGATGCAGCAGTTGCGGGAGAAGGATGATGCAAATTTCAAGCTCATGTCAGAGCGTATCAAGTCTAATCAGATCCATAAGTTACTTAAAGAAGAGAAGGAGGAGCTGGCTGACCAGGTTTTGACTCTGAAGACTCAGGTTGATGCCCAGTTACAGGTAGTAAGGAAACTGGAGGAGAAGGAGCATCTATTACAGAGCAACATTGGCACAGGGGAGAAGGAGCTGGGTCTTAGGACGCAAGCCTTAGAGATGAATAAACGCAAGGCAATGGAGGCAGCCCAGCTTGCAGATGACCTCAAAGCACAGTTGGAGTTGGCTCAGAAGAAGCTGCATGATTTTCAGGATGAGATCGTGGAGAACAGTGTCACCAAAGAAAAGGACATGTTCAATTTCAAACGTGCCCAGGAGGACATCTCTAGACTTCGAAGGAAGCTGGAGACCACAAAGAAACCAGACAATGTACCCAAATGCGATGAGATTCTGATGGAG