Transcript asmbl_2575

Sequence
Transcript Sequence for observation asmbl_2575 of TGE0004503:
ACACAAGAGTTTCAAATGACCTAGTTTGAAGCTTTGATTGAGAGTAGTATTGGGGAGGGACAAGTGTGTGTGTTGTGAGTGAACATGGAGTAGGAAGCTGTGGTAAGATTCAAACTGGGGTAACATCACACTCTGTCCTCTACTTTAATGAGGCAGGATTGCAGATGTTATGGGCTGATGCCAAAAAGGCTAGAAGAATAAAGACAAATATGTGGAAGCACAATATAAAGTTTCATCAACTTTCATACCGGGAGATGGAGCATTTGAGACAGTTCCGTCGAGACGTCACCAAGTGTCTTTTCCTAGGTATTATTTCCATTCCACCCTTTGCCAACTACCTGGTCTTCTTGCTAATGTACCTGTTTCCTAGACAACTACTGATCAAACATTTCTGGACTGCCAAGCAACAGATTGATTTCTTAGATATCTATCATGCTCTCCGGAAGCAGTCCCACCCAGAAATTCTTTGTTATTTAGAAAAAATTATCCCTCTCATTTCTGATGCAGGACTCCGGTGGCATGTGACAGAGTTGTGCACCAAGCTACAGCGTGGTACCCATCCAGCAATACATGACATCCTGGCTCTGAGAGAGTGTTTCTCTAATCATCCTCTGAGTATGAACCAACTCCACGCTTTGCAACTGAAAGCCTTGAGTCGAGCCATGCTTCTCACACCTTATCTGCCTTCTTTCTTGTTGAGACACCGTTTAAAGGCTCATACCACTGTGATTCACCAACTGGACAAGGCTTTGGCAAAGTTGGGGATTGGCCAGCTGACTGCTCAGGAAGTGAGATCGGCTTGTTATCTTCGTGGTCTGAATTCTACCCATATTGCTGAAGAGAGGTGTCGAACTTGGCTCGGAGAATGGCTACAGATTTCCTGCAGTCTGAAAGAAGCTGAGCTGTCCCTCTTGCTACACAACGTGTTCCTGCTTTCCACCAACTACATTGGGACAAGGCGCTGAGTGCACATGGAGCAGATGGCATTGTCCTGCAGTCACACAATACAGCAGCATCGGACCAAACGGCACTTGTCAGTAATCTGTGTGCAGTTAGATGTGTGTAAGGCAGAGGAGGGGGTGCCACAGGCTTTATAGTGTGGTACCCATGTGGGAGCTGGAACTAAAACAAACCCTCACCAGAGATGGCCCATGTGTGGTGTCATCCCAACTTCCTTGGAATTAGCTGTAGCTGGCAGCAGCCCCTGTACAAGGCTTTGACTGTGATATGTTAAGTTCGGATCCTAGGAAGTGAGCTCTTGCCCCCGGTGGAAATCCTCATCGTTTGGCCCAGGACTTACCACTGCCATAT