Transcript asmbl_2574

Sequence
Transcript Sequence for observation asmbl_2574 of TGE0004502:
AGGGTGTGCTGGGCTCGGACTGCTCTATGGGTTTCGACGGTCACCCCTGGATCTTATGTCAACCGGAGGCTGCAGCTTGTTCGCTATGGACTGGCCTGGGGGGGCCCTCGGTCTTCAAAGCTTCACCTTTCTCCAAAGGCAGATGTGAAGAGCTTAATCTCTTATGTGGTGACCAAGACAAAAGTGATTAATGGGAAATACCACCGTTTTTTGGGTCGTCATTTCCCCCGCTTCTATATCCTGTACACAACTTTCATGAAAGGATTGCAGATGTTATGGGCTGATGCCAAAAAGGCTAGAAGAATAAAGACAAATATGTGGAAGCACAATATAAAGTTTCATCAACTTTCATACCGGGAGATGGAGCATTTGAGACAGTTCCGTCGAGACGTCACCAAGTGTCTTTTCCTAGGTATTATTTCCATTCCACCCTTTGCCAACTACCTGGTCTTCTTGCTAATGTACCTGTTTCCTAGACAACTACTGATCAAACATTTCTGGACTGCCAAGCAACAGATTGATTTCTTAGATATCTATCATGCTCTCCGGAAGCAGTCCCACCCAGAAATTCTTTGTTATTTAGAAAAAATTATCCCTCTCATTTCTGATGCAGGACTCCGGTGGCATGTGACAGAGTTGTGCACCAAGCTACAGCGTGGTACCCATCCAGCAATACATGACATCCTGGCTCTGAGAGAGTGTTTCTCTAATCATCCTCTGAGTATGAACCAACTCCACGCTTTGCAACTGAAAGCCTTGAGTCGAGCCATGCTTCTCACACCTTATCTGCCTTCTTTCTTGTTGAGACACCGTTTAAAGGCTCATACCACTGTGATTCACCAACTGGACAAGGCTTTGGCAAAGTTGGGGATTGGCCAGCTGACTGCTCAGGAAGTGAGATCGGCTTGTTATCTTCGTGGTCTGAATTCTACCCATATTGCTGAAGAGAGGTGTCGAACTTGGCTCGGAGAATGGCTACAGATTTCCTGCAGTCTGAAAGAAGCTGAGCTGTCCCTCTTGCTACACAACGTGTTCCTGCTTTCCACCAACTACATTGGGACAAGGCGCTGAGTGCACATGGAGCAGATGGCATTGTCCTGCAGTCACACAATACAGCAGCATCGGACCAAACGGCACTTGTCAGTAATCTGTGTGCAGTTAGATGTGTGTAAGGCAGAGGAGGGGGTGCCACAGGCTTTATAGTGTGGTACCCATGTGGGAGCTGGAACTAAAACAAACCCTCACCAGAGATGGCCCATGTGTGGTGTCATCCCAACTTCCTTGGAATTAGCTGTAGCTGGCAGCAGCCCCTGTACAAGGCTTTGACTGTGATATGTTAAGTTCGGATCCTAGGAAGTGAGCTCTTGCCCCCGGTGGAAATCCTCATCGTTTGGCCCAGGACTTACCACTGCCATAT