Transcript asmbl_17694

Sequence
Transcript Sequence for observation asmbl_17694 of TGE0000458:
CGTTTCCACGGACGCCCAGGAGACAGCCGGTTGCTGAGCCGGGAGCGCTGACTGGCCCGGCTGGGCAGGTCTTGACTCGTCTGCTGAACAAATCCTCTGACCTCAGGCCGGCTGTGAACGTAGTTCCTGAGAGATAGCAAACATGCCCAACAGTGAGCCCGCATCTCTGCTGGAGCTGTTCAACAGCATCGCCACACAAGGGGAGCTCGTAAGGTCCCTCAAAGCGGGAAATGCGTCAAAGGATGAAATTGATTCTGCAGTAAAGATGTTGGTGTCATTAAAAATGAGCTACAAAGCTGCCGCGGGGGAGGATTACAAGGCTGACTGTCCTCCAGGGAACCCAGCACCTACCAGTAATCATGGCCCAGATGCCACAGAAGCTGAAGAGGATTTTGTGGACCCATGGACAGTACAGACAAGCAGTGCAAAAGGCATAGACTACGATAAGCTCATTGTTCGGTTTGGAAGTAGTAAAATTGACAAAGAGCTAATAAACCGAATAGAGAGAGCCACCGGCCAAAGACCACACCACTTCCTGCGCAGAGGCATCTTCTTCTCACACAGAGATATGAATCAGGTTCTTGATGCCTATGAAAATAAGAAGCCATTTTATCTGTACACGGGCCGGGGCCCCTCTTCTGAAGCAATGCATGTAGGTCACCTCATTCCATTTATTTTCACAAAGTGGCTCCAGGATGTATTTAACGTGCCCTTGGTCATCCAGATGACGGATGACGAGAAGTATCTGTGGAAGGACCTGACCCTGGACCAGGCCTATAGCTATGCTGTGGAGAATGCCAAGGACATCATCGCCTGTGGCTTTGACATCAACAAGACTTTCATATTCTCTGACCTGGACTACATGGGGATGAGCTCAGGTTTCTACAAAAATGTGGTGAAGATTCAAAAGCATGTTACCTTCAACCAAGTGAAAGGCATTTTCGGCTTCACTGACAGCGACTGCATTGGGAAGATCAGTTTTCCTGCCATCCAGGCTGCTCCCTCCTTCAGCAACTCATTCCCACAGATCTTCCGAGACAGGACGGATATCCAGTGCCTTATCCCATGTGCCATTGACCAGGATCCTTACTTTAGAATGACAAGGGACGTCGCCCCCAGGATCGGCTATCCTAAACCAGCCCTGCTGCACTCCACCTTCTTCCCAGCCCTGCAGGGCGCCCAGACCAAAATGAGTGCCAGCGACCCCAACTCCTCCATCTTCCTCACCGACACGGCCAAGCAGATCAAAACCAAGGTCAATAAGCATGCGTTTTCTGGAGGGAGAGACACCATCGAGGAGCACAGGCAGTTTGGGGGCAACTGTGATGTGGACGTGTCTTTCATGTACCTGACCTTCTTCCTCGAGGACGACGACAAGCTCGAGCAGATCAGGAAGGATTACACCAGCGGAGCCATGCTCACCGGTGAGCTCAAGAAGGCACTCATAGAGGTTCTGCAGCCCTTGATCGCAGAGCACCAGGCCCGGCGCAAGGAGGTCACGGATGAGATAGTGAAAGAGTTCATGACTCCCCGGAAGCTGTCCTTCGACTTTCAGTAGCACTCGTTTTACATATGCTTATAAAAGAAGTGATGTATCAGTAATGTATCAATAATCCCAGCCCAGTCAAAGCACCGCCACCTGTAGGCTTCTGTCTCATGGTAATTACTGGGCCTGGCCTCTGTAAGCCTGTGTATGTTATCAATACTGTTTCTTCCTGTGAGTTCCATTATTTCTATCTCTTATGGGCAAAGCATTGTGGGTAATTGGTGCTGGCTAACATTGCATGGTCGGATAGAGAAGTCCAGCTGTGAGTCTCTCCCCAAAGCAGCCCCACAGTGGAGCCTTTGGCTGGAAGTCCATGGGCCACCCTGTTCTTGTCCATGGAGGACTCCGAGGGTTCCAAGTATACTCTTAAGACCCACTCTGTTTAAAAATATATATTCTATGTATGCGTATATGGAATTGAAATGTCATTATTGTAACCTAGAAAGTGCTTTGAAATATTGATGTGGGGAGGTTTATTGAGCACAAGATGTATTTCAGCCCATGCCCCCTCCCAAAAAGAAATTGATAAGTAAAAGCTTCGTTATACATTTGACTAAGAAATCACCCAGCTTTAAAGCTGCTTTTAACAATGAAGATTGAACAGAGTTCAGCAATTTTGATTAAATTAAGACTTGGGGGTGAAACTTTCCAGTTTACTGAACTCCAGACCATGCATGTAGTCCACTCCAGAAATCATGCTCGCTTCCCTTGGCACACCAGTGTTCTCCTGCCAAATGACCCTAGACCCTCTGTCCTGCAGAGTCAGGGTGGCTTTTCCCCTGACTGTGTCCGATGCCAAGGAGTCCTGGCCTCCGCAGATGCTTCATTTTGACCCTTGGCTGCAGTGGAAGTCAGCACAGAGCAGTGCCCTGGCTGTGTCCCTGGACGGGTGGACTTAGCTAGGGAGAAAGTCGAGGCAGCAGCCCTCGAGGCCCTCACAGATGTCTAGGCAGGCCTCATTTCATCACGCAGCATGTGCAGGCCTGGAAGAGCAAAGCCAAATCTCAGGGAAGTCCTTGGTTGATGTATCTGGGTCTCCTCTGGAGCACTCTGCCCTCCTGTCACCCAGTAGAGTAAATAAACTTCCTTGGCTCCTGC