Transcript asmbl_47783

Sequence
Transcript Sequence for observation asmbl_47783 of TGE0006056:
GTGAAAGAGTTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGGAAAATCCTGCTCAGAATACAGCCCATTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACAGGCTCCTTCGGGCGGGTGATGCTAGTAAAACACAAGGAGACCGGGAGCCACTTCGCCATGAAGATCCTGGACAAACAGAAGGTGGTAAAGCTGAAACAGATCGAGCACACCCTGAACGAGAAGCGCATCCTGCAGGCAGTCAACTTTCCGTTCCTCGTTAGACTCGAGTTCTCCTTCAAGGACAACTCAAATTTATACATGATCATGGAGTATGTGCCTGGCGGGGAAATGTTCTCACACCTGCGGCGGATCGGAAGGTTCAGCGAGCCCCATGCCCGCTTCTACGCCGCCCAGATCGTCCTGACCTTCGAGTACCTGCACTCCCTTGATCTCATCTACCGGGACCTGAAGCCGGAGAACCTTCTCATCGACCAGCAGGGCTACATTCAGGTTACAGACTTTGGTTTTGCCAAGCGTGTGAAAGGCCGCACCTGGACCTTGTGTGGGACCCCTGAGTACCTGGCCCCTGAGATCATACTGAGCAAAGGCTACAACAAGGCTGTGGACTGGTGGGCACTGGGGGTTCTCATCTATGAGATGGCCGCCGGCTACCCACCCTTCTTCGCTGACCAGCCCATCCAGATCTATGAGAAGATTGTCTCTGGGAAGGTGCGGTTCCCGTCTCACTTCAGCTCTGACCTGAAGGATCTGCTGCGGAACCTACTGCAGGTGGACCTCACCAAGCGCTTTGGGAACCTCAAGAATGGGGTCAATGACATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATCGCCATCTACCAGAGGAAGGTGGAAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGACACGAGTAACTTTGACGACTATGAGGAGGAAGAGATTCGAGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAGGGGTGTGCCTGTGCCCCCAAGGGTTTTTTCTTTTTTTGTGTGGGG