Transcript asmbl_47224

Sequence
Transcript Sequence for observation asmbl_47224 of TGE0006025:
CGGCTTCCGCTACGCCCTGACAACAGCGGGGTCTCTGACTACGCTGGGGTGGGCTACCGTGGGCCTCCGGGCGGCGGTCAACGATGCTGAAGGCCAAGATCCTCTTCGTGGGGCCCTGCGAGAGTGGAAAAACCGTTTTGGCCAACTTCCTGACAGAATCTTCTGACATCACCGAATACAACCCAACCCAAGGAGTGAGGATCCTGGAGTTTGAGAACCCACATGTTACCAGCAACAACAAAGGCACCGGGTGTGAATTTGAACTATGGGATTGTGGCGGTGATCCAAAATTTGAGTCTTGCTGGCCAGCCTTGATGAAGGACTCTCACGGAGTGGTGATCATCTTCAATGCTGACATCCCAAGCCACTTGAAGGAAATCGAGATGTGGTATTCCTGCTTTGTCCAGCAGCAGTTCCTGCAGGATACTCAGTGTCTGTTAATTGCACACCACAAACCAGGCTCTGGAAGTGGTAAAGGAAACCTATCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTACACTCAAATCTTGAGGATGACCCTGAAGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCAGTGTCTGAGAGCAGAGACCGGGAGGAGATGTCCATTATTACCTAACCAGCCTTCATCTGGACTCTTCTGCATCCCAAGTGAGGTCAACTTCTTTCCCAGTGCAGATCTGAAATCTTACCCAGTTACTGATGTTTTCTTCTCCCAATGGCCCTTGAAAAAATTTTCCTTCCCTGCTTGCAGGTACCAGTTGCCCAGGGAGTTGAATCATACAATCTAAGCCCTGTCCTTAGTTCAGGTGAGAAAATCCTGTTACTGAATTTTGATTTCTTTGCCCCAGGTTGCTTCAAAGAGCTGGAAAACTGAGGTGTTTTGTTTTCCCCTTCACATATGTCAAGTTATAAAACTTGTGGAATTGTAACTGTCATAGCCTAATCCATGCGTATTGGTTTGAATGTGATTTTCATTTCTTAATTCACTCAACAAATAGCGACTTGTTGAGCATCTACTATTGGCTACACTGTTCTAGTTGCAGACAGTATACAGCATGAACAAAATAAAAACCCTTGCTCTCATGGAACTTCTATTATAAAAAAATAGTGAGGTAGTCAAAAACTGAATTACTATACCTTGGATATGCAAAAAAAAAATATTATGGATTCTTCTTTTCTGTAATTGGTCTAACTCTAATGCACCTACCCTCCTAGATAATTAACAGACTTGGAGTATGTAACATGCAAAGGAAGGTACAGTCAGTCCTCATTCATGGATTTTGTATTTGCGAATTTGCCTACTTGCTAAAATTTATTTGTAACCCCCAAATCAATACTCACAATGCTTTGACAGTTATTCAGAGTGGCAAAAAATTTGAATCACTGGATACGCACATTCCCAACTGAGGCCGAAACAAGAAGGCAGCGCTCTGCCTTCTTGTTTCAGCTGTTGTATTGTAAACCAGTGTCCTTGTTGTGGTATATTTAGTACCACTTTTTCATATTTTTGTGCTTCTCATTGGTTATTATTTTGTTGGTTATTAAAATGCCCCTCCCCCCAAACGTAGTGCTGAAGTGCTGTCTGGTGGTTCCTAAGCACAAAAAGGCTGTGATGTGCCTTATGATGAAAATAGATATGTTAGATAAGCCTCATTCCAGCATGAATTATAGTGCTGTTAGTTGTGAGTGCAGTGTTAATCAACAACATATATTAAATAAAGTATCTTTAAACAGAAGCATACAGAAAATAAAGTTATGTATTAATAGTTGAAAATATTGTGATCAGAGGCACGCAGGAACCTAACCCTGTATTTCCCTGGGAGAAATGCTTTGGTGTTCATTAATCCATTGTTTGTGGTAACATTACAGAACATAATGACCATGAATAATGAGAATCCACTGTATTTCCATCTCTTGCAATTTAAATGTTTTCAGGTTAGTTCAGCCTCTAATAAATATTTAATTAATTCAAA