Transcript asmbl_47209

Sequence
Transcript Sequence for observation asmbl_47209 of TGE0006023:
AGGGGAAGTGCAGCCAAGAACCCCTGTGCAGTGTGGAGGTCGTAGGAGTCACTTACTCACCGCCAGGTCCTTCGCTTGCTGGTCCGCGCCCCGCCCGCCGCAGCCATGCTCTCAGCCCTTGCCCGGCCTTCCGGCGCCGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAGGTAGCCGTGCTCGGGGCTTCTGGAGGAATTGGGCAGCCCCTTTCACTTCTCCTGAAGAACAGTCCTTTGGTGAGCCGCCTGACCCTCTACGATATTGCTCATACGCCTGGAGTGGCGGCGGATCTGAGCCACATCGAGACCAGAGCAAATGTGAAAGGCTACCTCGGACCTGAGCAGCTGCCCGAATGCCTGAAAGGTTGTGATTTGGTGGTTATTCCAGCCGGAGTCCCAAGAAAACCAGGCATGACACGGGATGACCTGTTCAACACCAATGCCACAATTGTGGCCACCTTGACTGCTGCGTGTGCTCAACATTGCCCTGACGCCATGATCTGTGTCATTGCAAATCCGGTCAACTCCACCATCCCAATCACGTCAGAAGTTTTCAAGAAACATGGAGTATACAACCCCAGTAAAATCTTTGGGGTGACGACCCTGGATATTGTCAGAGCCAACACTTTTGTTGCAGAACTGAAGGGTTTGGATCCAGCTCGAGTCAATGTCCCTGTCATTGGCGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACTCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCGCTTACTGGGCGGATCCAGGAGGCTGGCACGGAGGTGGTCAAGGCTAAAGCTGGAGCAGGCTCTGCCACCCTGTCCATGGCATATGCCGGAGCCCGGTTTGTCTTTTCCCTTGTGGATGCAATCAACGGAAAGGAAGGAGTGGTTGAATGTTCTTTTGTTAAATCCCAAGAAACGGACTGTCCCTATTTCTCCACACCATTGCTGCTTGGAAAAAAGGGCATCGAGAAAAATCTAGGCATTGGCAAAGTTTCCCCTTTTGAAGAGAAGATGATAGCTGATGCCATTCCTGAGCTGAAAGCCTCAATCAAGAAAGGAGAAGAGTTTGTGAAGAACATGAAATGAGAAAACTGTTAGCAGGCAGTCCATTTCCTTAACTTATTAAGGCATTCTGTCACTGTAAAGCATTTCAGATTTCTTTGTATTTCATTTTGCTTTAACGATGAATATTGTATTAATGTTACCATCCCTTCCTAGTTGCGGATCAGTCTATTGGTGCATCAATAAAAGTAGGCTTTGATTTTCTTTTTCAAGGTCTCTGCCATAAATATTGTGCTTTCTTCCCTACTAGAGCTGACTTGAGTGTCT