Transcript asmbl_47113

Sequence
Transcript Sequence for observation asmbl_47113 of TGE0030618:
CGCTCTCTCTCTCTCTCTCTCTCCCCCGCTTCCCATCATCCCCCGGTGCTCCCGGCCTTCTTTGGTTTAGTTCTAGTTAGAGCGGCGCGGGGAGTAGTTTGTAGTTCGAGGCGCCGTTCCGCGAGTGACGCAGGCGCTACGCGAGTGGCGCGCGCCGACTGCCCGTCCTCTGCTGTCCCCCTTTCTTCGCGTCTCGGCCCCGTAGCTTAGAGCGTCTTGTTTCTTTCTCACCCTCTGCGTCGTTTTCATCGCGCGCCAGAGGCAAGGGGCGGGCCTAGGTATCCTTGAGAACCAGCTAGCCGGAGCTCGAGACTAACGGCCGCGACTCCTCCCAGGCCTCTTCAGACCGCGTCATGGGTGACAGTGACGACGAGTACGATAGAAGGCGCAGGGACAAGTTTAGAAGAGAGCGCAGCGACTATGACCGTTCGCGGGAAAGAGATGAAAGACGTCGAGGGGACGATTGGAATGACCGAGAGTGGGACCGTGGCCGGGAGCGCCGTAGTCGGGGTGAATATCGTGACTATGACCGGAATCGGCGAGAGCGCTTCTCTCCTCCTCGCCATGAGCTCAGCCCCCCACAGAAGCGCATGAGGCGAGACTGGTGAGATGGCAACAGTTTCTTTGTCTTCCCTCACTTCTGCTGAGAACTTTCTGTGTCATTTCCTTTTCTTAAATGTTCATAAACCCATCTTTTTTTGTCCCTTTAAACCCTTGGGTGAGAGAGCACATTCCATATGTTCCCTCCCTCGGTCCTATCCTCCTTCATGCTCTGGAGCGATGATTCTCTCCTCTCTCTGACTTTTGTGTCCCCCACCCTCAGGGATGAGCACAGCTCTGACCCATACCACAGTGGCTATGAGATGCCCTATGCTGGGGGGGGTGGGGGCCCAACTTATGGCCCCCCTCAGCCCTGGGGCCACCCAGACGTCCACATCATGCAGCATCATGTTCTGCCTATCCAGGCCAGGCTGGGCAGCATAGCAGAGATTGACTTGGGTGTGCCACCACCGGTGATGAAGACGTTCAAGGAATTTCTCCTTTCGTTGGATGACTCTGTGGATGAGACAGAGGCAGTTAAGCGCTATAATGACTATAAGCTGGATTTTCGAAGACAGCAGATGCAGGATTTCTTCCTGGCTCATAAGGATGAGGAGTGGTTTCGGTCTAAGTACCACCCAGATGAGGTGGGGAAGCGTCGGCAGGAGGCTCGGGGGGCCCTGCAAAACCGACTGAGAGTATTTCTTTCCCTCATGGAGAGTGGCTGGTTTGATAATCTTCTTCTGGATATAGACAAAGCCGATGCCATTGTTAAGATGCTGGATGCAGCTGTAATTAAGATGGAAGGAGGTACAGAGAATGATCTACGCATCCTGGAGCAAGAGGAGGAAGAGGAACAGCCAGGAAAGCCCGGAGAGCCCAGCAAGAAAGAGGAAGGCCGGATTGGACCAGGCCCGGTGGATGGGGAGCGCAAGGCCAATGAGAAGGAAGACAAGAAGGAAGATGGCAAACAGGTCGAAAATGACAGTTCTAGTGATGACAAAACTAAGAAATCTGAGGGTGATGTGGACAAGGAAGAGAAGAAAGAAGATTCTGAGAAAGAAGCCAAAAAGAGTAGCAAGAAGCGGAATAGGAAGCATAGTGGTGACGACAGCTTTGATGAAGGCAGTGTGTCCGAGTCAGAGTCAGAATCTGAGAGTGGCCAAGCTGAGGAAGAGAAGGAGGAGGCTGAAGCAGCGCTCAAGGAAAAGGAGAAGCCCAAGGAAGAAGAAAGGGAGAAGCCCAAGGACACTCCTGGGCTGGAATGTAAACCCCGGCCCCTGCATAAGACTTGTTCTCTCTTCATGCGCAACATCGCACCCAACATCTCCCGGGCTGAGATAATTTCTCTTTGTAAAAGATATCCAGGTTTTATGCGTGTGGCACTATCAGAGCCCCAGCCTGAGAGGAGGTTTTTCCGTCGTGGCTGGGTGACATTTGACCGCAGTGTTAACATCAAAGAGATCTGTTGGAACCTGCAGAATATCAGAGTGAGTGCTGGGAGCGGGACTGTTTTAAG