Transcript asmbl_47058

Sequence
Transcript Sequence for observation asmbl_47058 of TGE0030607:
CAGGCCCTTCTGAAACTGATGATGTTGATGACAAACTCCCCCTTTCGAAGTCTTTGCAAGGAAGCCATCATTCTTCAGAGGGCAATGATGGAACAGAAATGGAAGTACCAGCAGAAGATTCTACTCAACATGTCCCTTCAGAAACAAGTGAGGACCCCGAAGTTGAGGTGACTATTGAAGATGATGATTATTCTCCACCTACTAAGAGACCAAAGAGCAATGAGCCACCCCAGCCACCAGTCACAGAACCCGCCAATGCCGGAAAACGGAAAGTGAGAGAGTTCAACTTTGAGAAATGGAATGCTCGAATTACTGATCTGCGTAAACAAGTCGAAGAGTTGTTTGAAAGAAAATATGCTCAAGCTATAAAAGCCAAAGGTCCTGTGACGATCCCATACCCTCTTTTCCAGTCACATGTTGAAGATCTATATGTGGAAGGACTTCCAGAAGGAATTCCTTTTAGAAGGCCATCTACTTATGGAATTCCTCGCCTTGAGAGAATATTACTTGCAAAGGAAAGGATTCGTTTTGTGATTAAGAAACACGAACTTCTGAATTCAACACGCGAAGACCTACAACTTGATAAACCAGCTTCAGGAGTAAAGGAAGAGTGGTATGCCAGAATCACTAAATTACGAAAGATGGTAGATCAGCTTTTCTGCAAAAAATTTGCTGAAGCCTTGGGGAGTACTGAAGCCAAGGCTGTACCTTACCAGAAGTTCGAGGCACATCCTAATGATCTCTATGTGGAAGGACTTCCAGAAAATATTCCTTTTAGAAGTCCCTCGTGGTATGGAATCCCAAGGCTTGAAAAAATCATTCAAGTGGGCAATCGAATTAAATTTGTTATTAAAAGACCAGAACTTCTGACTCACAGTACTACTGAAGTTACTCAGCCAAGAACGAATACACCAGTCAAAGAAGATTGGAATGTCAGAATTACTAAACTACGAAAGCAAGTGGAAGAGATTTTTAATTTGAAATTTGCTCAAGCTCTTGGACTCACAGAGGCAGTAAAAGTACCATATCCTGTGTTTGAATCAAATCCTGAGTTCCTTTACGTAGAAGGCTTGCCAGAAGGAATTCCCTTTCGAAGTCCTACCTGGTTTGGAATTCCACGACTTGAAAGGATTGTCCGTGGCAGTAATAAAATCAAGTTTGTTGTCAAAAAACCTGAACTAGTTATTTCCTACTTGCCTCCTGGAATGGCTAGTAAAATAAACACTAAAGCCTTGCAGTCCCCGAAAAGACCACGAAGCCCTGGGAGTAATTCAAAAGTTCCTGAAATTGAGGTCACTGTGGAAGGCCCTAATAACAACAACCCTCAGACCTCAGCTGTGCGAACCCCTACCCAGACTAATGGTTCTAATGTTCCTTTTAAGCCTCGAGGGAGAGAGTTTTCCTTTGAGGCATGGAATGCCAAAATCACAGACCTAAAACAAAAAGTTGAAAATCTTTTCAATGAAAAATGTGGTGAAGCTCTCGGCCTTAAACAAGCTGTGAAAGTGCCATTTGCATTATTTGAGTCTTTCCCAGAAGACTTTTATGTAGAAGGCTTACCGGAGGGTGTGCCATTTCGTCGACCATCTACTTTTGGCATTCCAAGGCTGGAGAAGATACTCAGAAACAAAGCCAAAATTAAGTTCATTATTAAAAAGCCCGAAATGTTTGAGACAGCAATTAAGGAGAGCACCTCCTCCTCTAAGAGCCCTCCAAGAAAAATAAATTCGTCGCCCAATGTTAATACTACTGCATCAGGTGTTGAAGATCTTAACATCATTCAGGTGACAATTCCAGACGATGATAATGAAAGACTGTCTAAAGTTGAAAAAGCTAGACAGCTAAGAGAACAAGTTAATGACCTCTTCAGTCGAAAATTCGGTGAAGCTATTGGTATGGGTTTCCCTGTGAAAGTTCCCTACAGGAAAATCACAATTAACCCTGGCTGTGTGGTAGTTGATGGCATGCCTCCTGGAGTGTCATTCAAAGCTCCCAGCTACCTGGAAATCAGTTCCATGAGAAGGATTTTAGATTCTGCTGAGTTCATTAAGTTCACAGTCATTAGACCATTTCCAGGACTTGTGATTAATAACCAGTTGGTTGATCAGAATGAGTCAGAAAGCCCAGTGATCCAAGAATCAGCTGAACCAAGCCAGTTGGAGGTTCCTGCAACAGAAGAAATAAAGGAGTCTGATGGAAGCTCTCAGATCAAGCAAGAACCAGACCCTACGTGGTAGACCTCTTCCCTCCTAGGCTTAAAGTATCAGTGGGTGAGAAGAGCTTTTCGGACCTGTTACTGCCCCAAGCTGTGTAATATACTTGTATAACAGAAATACCTTCTATACAAACCTTTTTTTCTACTTTTAGATAGAAATGTCTACTTTTTCAGCAGTTCTGTGAATTGAATTAAAGAGCAGAGTGACTGTAGATTTGGAATGGCTGGTTTACTTTGGAATGTATTATAAGGATTTTACAGCAATGCTGGAAAAACGACAGGGAAAATGACAGGGATGAATCTCACCAGATTTTTTTTATGGATTCAGCAGAGCCTTCAGCTATGGTGTTTATTTTCCAATCAAGTGAAGATATCTCTTACTGGAACATCTCAGCTTCTGCAGTGAAGAAAACACCTGTGATAGTTTAGTTCTTTAGTTTTTCTATTTGAAAAATCATTTAAATGATCCTTTTGTTCACGGCTCTCCTTAATGACTGAGTGAACAGTTAGTATCTGTATATTTGACTAAACCTTTTCCTAAGCTATCTATCATGGTTCATACGTTTTTTATCATAATTAAAAAACAACCATCTGGATTATCTAATAGCCGGTAAGAGGTCAGTATCTCAGTGTGTGGCTTATAGATGGAATACAGAGAACCTCTTCCACATTTACTTTTCATCCAAATAAAATGCATGGTGTACCAGAAGTTTAAGATCAGGTATGACTGTTTGGGCAAGCTAAATGACACTAAAGCCTCACTATCATGTAACCTGTTGTGGTGTGGATTTCTTTGGAACACTGTTCCAGCTTGAATCAATCTCAAGGGGTTTTCATTGCCGTCATTATTTTATAATTCTACTTGTAAAATTGAGGCTCCAGTGTGGGGAATGAAGGGTCATAAGCTAATTATGCACCCACTGATATTCTGCGCCATTTGTAGGAGAATCTTACACATGTTGAGATTTCACAGACAATAAGAGTTGTAAAATCCAAGCTATATGAAAAGCTAGAGTATGTGATGGCATAGAGTGTTCATTAGCTTTATCACAATATTCACAATGGAGAATTATATTACATGGTAGCAGGGATAGGCATTTTTATGTGTTGCTTATATTTTACCTCAAATTAAAATGTAGATATAGGGTAATAAATAAAAT