Transcript asmbl_47030

Sequence
Transcript Sequence for observation asmbl_47030 of TGE0006011:
CGGAAGGCCCTTGCCTGTGTGCTGATTGGTCGCGCGCTGAGGCCGGACCCGCCTCCCGTCTTCCTCTCTCTACCTCAGCAGAAGCCGCCGGGGTCTTCTTGGAGTCTAACTGTTGTAGACGCCCACCCGCTGTGCAGTTGCGATGCCGCGTGGTAGCCGAAGCCGCACCTCCCGCATGGCCCCGCCGTCCAGCCGGGCACCTCAGATGAGAGCTGCGCCCAGACCAGCGCCAGCAGCCCAGCTGCCAGCAGCAGCTCCACCATCTGCTGTTGGCTCACCTGCTGCTGCACCCCGGCAGCCAGGTCTGATGGCCCAGATGGCAACTACTGCAGCTGGTGTAGCTGTGGGCTCTGCTGTTGGCCACACGCTAGGTCATGCCATCACTGGGGGCTTCGGTGGAAGTAACACTGAGCCCTCAAGGCCTGACATCACTTACCAGGAGCCACAGGGAACCCAGCCGGCATACCAGCAGCAGCAGCAGTTTGGCCCATGCCACTATGAGATGAAACAGTTTTTGGAGTGTGCCCAGAACCAGGGTGACCTTAAGCTTTGTGAGGGTTTCAGCGAGGTGCTGAAACAGTGCAGATTTGCAAATGGATTAGCCTAATCAAGAAGTTCAAATTGAAGACATGGAAAATCATCTCTCACGACCAAGTTAATTTAGTATAAAAATATAATGGATAGTGAAAGTATAAAGTGTAAAACCACCAGTTAAACCTCTCTATTATTAATAGCTTCCTTGCCTCAGAATTGCAGTGGAAGAGAGTGTTCATACTGTATAGTTCATTGAGATGGTATTGAGTTTGGGGTTGGGCAGATGGTTTTGTGGGCTCCTTAAACCAGGTTTTGTGATGTTATTTGTGAATCGATTAGAATAAAGTGATTTTCTTCCAAAATGATGTCTGATAAATGTAAGGTCGTAAATTAAATACTGTATATGCATGCTGAACATATGCATTTTGCAGAACACAATCATCGTGTCTTTAAGTTTATCTAGTTTATAGTCTCTGGTATTAGCATCCACCCAGAGCATCTGGTAGAACTCCCTGAGGAACTTTTGTAGAGAAACAGTTATGTAAAGAGGAGCTCACTAGCAAATATGCTGCTCATTAAAAGGGTTCCACGTACTACAGGCCTTTGGAGTCAATGTT