Transcript asmbl_46585

Sequence
Transcript Sequence for observation asmbl_46585 of TGE0005978:
GCCCAAGGCTTCACTTCCAGTGTGAAACAGTCGGAGAAGAATCTCTCTTTAGCTTCTGAAAAGAAGGTGGAAAAAAAGAAACTTCTTCAAAAATGTCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATACGTTAAAACTGTGAAAGCATCCAAAGGTGGTCCTGGGTCAGCAGTGAGCCCCTATCCTAGCTTCAATCCATCCTCAGATGTCGATGCCTTGCATAAAGCAATCATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGAGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAAAAGGAAAGCCCCTGGATGAAGTTCTGAAGAAAGCCCTGACAGGTCACCTTGAAGAAGTTGCTTTGGCTCTATTAAAAACTCCAGCCCGGTTTGATGCTGATGAACTGCGTGCTGCCATGAAGGGCCTTGGAACAGATGAAGAGACTCTGGATGAAATTTTGGCATCAAGAACTAACAGAGAAATCAGAGAAATTAACAGAGTCTATAGAGAAGAATTGAAGAGAGATCTGGCTAAAGACATCACCTCAGACACATCTGGAGATTATCAGAAGGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGATATTGGCATAAATGAGGACTTGGCTGATTCAGATGCCAGGGCATTATATGAAGCAGGAGAAAGGAGAAAAGGGACAGATGTGAATGTGTTCACTACCATTCTTACCACCAGAAGCTACCCCCATCTTCGCAGAGTGTTTCAGAAGTACACCAAATACAGTCAGCATGACATGAACAAAGTTCTGGATCTGGAGATGAAAGGTGATATTGAGAAGTGCTTCACAACCATCGTGAAGTGTGCCACTAACAAACCAATGTTCTTTGCTGAGAAGCTTCATCAGGCCATGAAGGGTGCTGGAACGCGTCATAAGGCATTGATCAGAATTATGGTTTCCCGTTCTGAAATCGACATGAACGATATCAAAGCCTGCTATCAGAAGTTGTATGGTATCTCTCTCTGCCAAGCCATTCTGGATGAAACCAAAGGAGATTATGAAAAAATCCTGGTGGCTCTCTGCGGAGGACAGTAAATATTCCTTTAATGATCTCAAGCTTTTTGATCAGAAGATTTTTTAATCATATCTTTTCATTCCATATTACAGACTTAAATAGAAAAGTTTGTTCAGCAGAATTAGTTAGCTAACTGCTTTCTGAAAACTATGGCTTATAAATCATTTTTATATCATAACTCTGTATAATAGAGATAAGTTTTTTAAAAATTTATTTACCCCAATTATAAAACCCCACGAACAGGTTGTTCTAGTACCATTACTTGAGAAAGATGTTTATGTAACAGAAAATAAAATGATTTTACAGGACAATTGGTGTGTCATTGGTTCTTCTATTCTGATTTTTTTCTATGTGTAATGTAGTGGTTTAATTTGATATAAG