Transcript asmbl_2563

Sequence
Transcript Sequence for observation asmbl_2563 of TGE0004489:
CTGCGGTCTACCTGTGCCTGTGGCCCAGGCTTGCGTGGCGACTCAGGGGCAGAGGCGGAGCCTAGCCCGGCCAGACCCCACCTCCTCCGTCTGCGATATAACTTGAGTTGCAGATCTGGCACTCTCCGCGGCTCGAACCTGAGTCTTGGCTTCTCACCTTCCTCCGTGGACAACATGAGCTTCAGCACCCGCTCCAGCTTCTCCACCAGCTACCGGACCCTGGGCTCCGTGCAGACGCCCAGCCACCGGGTCCGGCCGGCCAGCAGCGCGGCCAGCGTGTATGCAGGTGCAGGGGGCTCCGGCTCCCGAATCTCTGTATCCCACTCCACCAGCGTCCGCGGTGGTTGGGGGTCCGGGGGCCTGGCCGCGGGGATGGCGGGAGGTCTAGCGGGCATAGGGGGCATCCAGACCGAGAAGGAGACTATGCAATGCTTGAATGACCGCCTGGCCTCCTACCTGGAGAGGGTGAGGAGCCTGGAGGCTGATAATCGGAGACTGGAGAGCAAAATCCGGGAACACCTGGAGAAGAAGGGACCCCAGGTCAGAGACTGGGGACATTACTTTAAGACCATCGAGGACCTGAGGGCTCAGATCTTTGCAAGTTCTGTGGACAATGCCCACATCGTTCTACAGATTGACAATGCCCGCCTTGCTGCTGATGACTTCAGAGTCAAGTAAGGCTGGAGGAGCTAGGGAGCTGGGGGTGGAGCTAAGAATGTTCTGCCCCTGGGGCTGGGTCAGCTAAGGGCTCACAGTGGGATCTTGTTCAACTGTGGGTGGAGCTGGGTGGATGAGAGTTAGGCTCCATCGGTTTATTTCTTATGTAACCCAGCTTGAGGAGACTGGCCCCCAACTGCCAGGAATGGTGCTCAGAGGATTATTATCTGATTCCTGACTCGGTTGCCAGTTTGTAGTGGGTACGGTGCTGCTCTTAGGAGGTGGTATAGGTTGAGAAGGTTCTGGATTAGAGATGGGTGCCCATCTGATCGCCTCCACTCCCACAGGTATGAGACGGAGCTGGCCATGCGCCAGTCTGTGGAGAGTGACATCAATGGGCTCCGAAAGGTCATCGATGACACCAATATCACTCGACTGCAGCTGGAGACAGAGATTGAGGCTCTCAAGGAGGAGCTGCTTTTCATGAAGAAGAACCATGAGGAGGCAAGGAGGGGCCACTGGCCAGGCCAGGAACCGGGGGCCAAGACAAGTCTGGGTGGGCAAATAGATGGAGCAGGCCACCTACAAGTAGTCTTACAGGGAAGTTCAGAACTACCAGCCTGGGCCGTACTTAGTGTGTCACCTGAGTTAGTGTGGTGAAATCAAGAGGCCATGGGTGAGAGAACGAGATGAAGACAAAGGTAGAAGCACTAGGAGTGAGGGGTGATGGAGGAGTGAGAGTAGGCGGAGCTGGCAGGGCTTGCTGAAAGAAGGTAAAGAGCAGGTTTATGGAAGGAGGCTTGATGGAGGGACAGGGTGAA