Transcript asmbl_46549

Sequence
Transcript Sequence for observation asmbl_46549 of TGE0005972:
CCGGTTCCTGCTCCATTCTGCGGTCCCAGAGCTTGAAGGCCTCTGCCACGGTCACCGTGACCCCGCGCCTCTGCCGCCCCCCGGCAGGTCAAGATGGGGTTTATATTTTCAAAAGCTATGAATGAAAACATGAAAAACCAACAGGAGTTTGCGTTAATGAATGCTCGACTTCAGCTAGAAAGGCAGCTAATAATGCAGAATGAAATGAGAGAAAGACAAATGGCCATGCAGATTGCTTGGTCTCGAGAATTCCTCAAATATTTCGGAACATTTTGTAGCCTTGCAGCAATCTCTTTAACAGCTGGAGCAATAAAAAGGAAGAAGCCAGCCTTCCTCTTTCCTCTTGTTCCATTAGGCTTTGTCTTTACCTACCAGTATGATTTAGGCTATGGAACCCTTCTACAAAGAATGAAAGGTGAAGCCGAGAACATACTGGAATCAGAAAAGAGTACATTGCAGTTGCCAAAAGGAATGATTACTTTCGAAAGCCTTGAACAAGCCAGAAAGGAACAAAGTAAATTCTTCATAGACAAATGAAATCATGTTTACCCACCAAATCTCAAAACACAGAATTGTTGACTCGAATCATGGTTTTTACAATTTCTTAAATGCTCGAGATCTTGATGTAATGGATTTTATTTTTAAATTTTAAAAATCAGTTTTGTTAAACTATTTTAAAGTAAAATTTATAACATTCAACAAAAAATGGAGGTTCTCTAAGTAACTTTCAGATTTCCTATATGTGTGTGTGTGTATAATAAATAAA