Transcript asmbl_46060

Sequence
Transcript Sequence for observation asmbl_46060 of TGE0030559:
GTAGCTTCCTCGATGTTAGGGGTAGAGCCTCTGTAGGGAGCTAACTGCCGTCCTTGCCCTCTCTTGTCCCCCTCTCGAATGCTGTCAGATACCATTCTTTGCTGGAACTGGGTGAGAAGCGGAAAGGCATGTTGGAGAAGAGTTGTAAGAAGTTTATGTTGTTCCGTGAAGCGAACGAGCTCCAGCAGTGGATCAACGAGAAGGAAGCGGCTCTGACGAGTGAAGAGGTCGGCGCGGACTTGGAGCAGGTCGAAGTGCTGCAGAAGAAGTTCGACGACTTCCAGAAGGATCTGAAGGCCAATGAGTCACGGCTGAAAGACATCAACAAGGTGGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCAGTCCAGCAGCAGGAGGTGTATGGCATGATGCCAAGGGATGACACCGATTCCAAGACAGCCTCCCCCTGGAAGTCTGCTCGCCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGTTGGCGGTCCCTGCAGCAGCTGGCCGAGGAGCGGAGCCAGCTCCTGGGCAGCGCCCATGAGGTGCAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAGTGGATCGAAGAGAAGAATCAGGCTCTAAACACAGACAATTACGGTCACGACCTGGCCAGTGTCCAAGCCCTGCAGCGCAAACACGAGGGTTTTGAGAGAGACCTCGCGGCTCTCGGCGACAAGGTAAATTCCCTCGGGGAAACAGCTGAGCGCCTGATCCAGTCTCACCCCGAGTCGGCGGAGGACCTCCAAGAGAAGTGCACGGAGTTAAACCAGGCGTGGAGCAGCCTGGGGAAGCGTGCAGACCAGCGCAAAGCCAAGCTGGGCGACTCGCACGACCTGCAGCGCTTCCTCAGCGACTTCCGGGACCTCATGTCTTGGATCAACGGAATACGTGGGTTGGTGTCCTCAGACGAGCTGGCCAGGGATGTCACTGGAGCCGAAGCTTTGCTGGAACGACACCAGGAACACCGGACAGAAATTGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGGCAGCAGCTGTTGGCTCATGGGCACTATGCCAGCCCAGAGATCAAGGAGAAACTAGACATTCTGGATCAGGAGCGTACAGACTTGGAGAAGGCCTGGGTGCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTTCATCGGGACTGCGAGCAGGCGGAGAACTGGATGGCTGCCCGGGAGGCCTTCCTGAATACCGAAGACAAAGGGGATTCGCTGGACAGTGTGGAGGCCCTGATCAAAAAACACGAGGACTTCGACAAAGCCATTAACGTCCAGGAGGAAAAGATTGCTGCTCTGCAGTCCTTTGCCGACCAACTCATCGCCGCCGGCCACTATGCCAAAGGCGACATTGCTAGCCGGCGCAATGAGGTTTTGGACAGATGGCGACGTCTAAAAGCCCAGATGATTGAGAAGAGGTCAAAGCTGGGAGAATCGCAAACCCTGCAGCAGTTCAGCCGGGACGTGGATGAGATTGAGGCTTGGATCAGCGAAAAATTACAGACCGCGAGCGATGAGTCATATAAGGATCCCACCAACATCCAGAGCAAGCACCAGAAGCACCAGGCCTTCGAAGCAGAGCTACACGCCAACGCTGACCGGATCCGCGGCGTCATTGACACCGGCAACTCCCTGATTGAACGTGGGGCCTGTGCCGGCAGCGAGGATGCCGTCAAGGCCCGGCTGGCTGCCTTGGCCGACCAGTGGCAATTCCTGGTGCAAAAGTCCGCTGAAAAGAGCCAGAAACTGAAAGAAGCCAATAAGCAGCAGAACTTCAACACGGGGATCAAGGACTTCGACTTCTGGCTCTCTGAGGTGGAAGCCCTTCTGGCATCTGAGGATTACGGCAAAGATCTTGCTTCTGTGAACAACTTGCTGAAAAAACATCAGCTACTGGAGGCGGATATATCTGCCCACGAGGATCGCCTGAAGGACCTGAACGGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCGAGTGAAAGACAAGCGGGACACCATCAACGGTCGTTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGAGCTCTGAGGACTATGGCCGAGACCTAACAGGTGTGCAGAACTTGAGGAAGAAGCACAAACGGCTGGAGGCAGAGCTGGCCGCGCACGAGCCTGCGATTCAGGGTGTCCTGGACACTGGAAAGAAGCTGTCTGACGACAACACCATCGGGAAGGAGGAGATCCAGCAGCGTCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCGGCGGCTCGGGGCCAGCGGCTAGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAACGTGGAAGAGGAGGAAGCCTGGATCAATGAGAAAATGACGCTGGTGGCCAGTGAAGATTATGGGGACACTCTGGCTGCTATCCAGGGCTTACTGAAGAAACACGAAGCTTTTGAGACGGACTTCACCGTCCACAAGGACCGCGTGAATGACGTCTGCACCAACGGACAAGACCTCGTCAAGAAGAACAATCACCACGAGGAGAACATCTCCTCAAAGATGAAGGGCTTGAATGGGAAAGTGTCTGACTTGGAGAAGGCCGCGGCGCAGAGGAAGGCGAAGCTCGACGAGAACTCGGCCTTCCTCCAGTTCAACTGGAAAGCCGACGTGGTGGAATCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGACTATGGCCGCGATCTCTCTTCTGTCCAAACTCTCCTTACCAAACAGGAAACCTTTGATGCTGGCCTGCAGGCCTTCCAGCAGGAGGGCATTGCCAACATCACTGCCCTCAAGGATCAGCTGCTGGCCGCCAAGCACATTCAGTCAAAGGCCATCGAGGCCCGGCACGCCGCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCACCCGGAAGAAGAAGCTGCTGGAAGCTCAGAGTCACTTCCGCAAGGTAGAGGACCTCTTCCTGACCTTTGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAACGCAGAGGAGGATCTGACAGACCCAGTGCGCTGCAACTCCCTGGAGGAGATCAAAGCCCTGCGAGAGGCCCATGACGCCTTCCGCTCCTCGCTCAGCTCCGCCCAGGCCGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTGGCCTCCAACCCCTACACCTGGTTCACCATGGAGGCCTTGGAGGAGACCTGGCGGAACCTGCAGAAGATCATCAAGGAAAGGGAGCTGGAGCTGCAGAAGGAGCAGCGCCGGCAGGAGGAGAATGACAAGCTGCGCCAGGAGTTCGCCCAGCACGCCAACGCATTCCACCAGTGGATCCAGGAGACCAGGTCCTGCATGGTGGAAGAGTCCGGGACCCTCGAATCCCAGCTCGAAGCTACCAAACGCAAGCACCAGGAGATTCGAGCAATGAGAAGTCAGCTGAAGAAGATTGAGGACCTGGGGGCAGCCATGGAGGAAGCCCTGATCCTGGACAACAAGTACACGGAGCACAGCACGGTGGGTCTGGCCCAGCAGTGGGACCAGCTTGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACGACAGGAGTGACCGAGGAAGCCCTCAAGGAGTTCAGCATGATGTTTAAACACTTTGACAAGGACAAATCTGGCCGCCTGAACCACCAGGAGTTCAAGTCCTGCCTGCGCTCCCTGGGCTACGACCTGCCCATGGTGGAGGAAGGGGAGCCTGACCCAGAGTTTGAGGCGATTCTGGACACTGTGGACCCGAACC