Transcript asmbl_45773

Sequence
Transcript Sequence for observation asmbl_45773 of TGE0005877:
CAGAGAAAACTAGGAAGATCCTGACGGAGTTCCTTCGTTTTTACGAGGACCAGTATGGTGTCGCCCTTTTCAACAGCATGCGCCACGAAATCGAGGGCACCGGGGTGCCGCAGGCCCAGCTGCTCTGGCGCAAGGTGCCGCTGGATGAGCGCATCATCTTCTCGGGGAACCTCTTCCAGCACCAGGAGGACAACAAGAAGTGGAGGAACCGCTTCAGCCTCGTGCCCCACAACTATGGGCTGGTTCTCTACGAGAACAAAGTGGCGTATGAGCGGCAGGTCCCACCCCGAGCTGTCATCAACAGCGCAGGCTACAAAATCCTCACATCCGTGGACCAGTACCTGGAGCTCGTTGGCAACTCCTTACCAGGGACCACCTCGAAATCGGGCTCCGCCCCCATCCTCAAGTGCCCCACGCAGTTCCCACTCATCCTCTGGCATCCTTCTGCACGACACTACTACTTCTGCATGATGACAGAAGCCGAGCAGGACAAGTGGCAGGCTGTCCTGCAGGACTGCATCCGGCACTGCAACAACGGGATCCCCGAGGACTCCAAGGTGGAGGGCCCTGCGTTCACGGACGCCATTCGCATGTACCGCCAGTCGAAGGAGCTGTATGGCACCTGGGAGATGCTGTGTGGCAACGAGGTGCAGATCCTGAGCAACCTGGTGATGGAGGAGCTGGGCCCTGAGCTGAAGGCGGAACTTGGCCCCCGGCTGAAGGGGAAACCACAGGAGCGGCAGCGGCAGTGGATCCAGATCTCGGATGCTGTGTACCGCATGGTGTACGAGCAGGCCGCAGCGCAGTTTGAGGCGGTGCTGTCCAAGCTGCAGCTGGCCCGGCCGGCCATGGAGGCGGTCATCCGCACCGACATGGACCAGATCATCACCTCCAAGGAGCATCTGGCCAGCAAGATCCGAGCCTTCATTCTCCCCAAGGCGGAGGTGTGTGTCCGGAACCACGTTCAGCCCTACATCCCGTCCATCCTGGAGGCCCTCATGGTGCCCACCAGCCAGGGCTTCACGGAGGTGCGGGACGTCTTCTTCAAGGAGGTCACCGACATAAACCTGAACATCATCAATGAGGGCGGCATCGACAAGCTGGGCGAGTACATGGAGAAGCTGTCCCAGCTGGCGTACCACCCCCTCAAGATGCAGAGCTGCTACGAGAAGATGGAGCCGCTGCGGCTTGATGGTCTGCAGCAGCGTTTCGACGTGTCCAGCACGTCCGTGTTCAAGCAGCGAGCCCAGATCCATATGCGTGAGCAAATGGACAATGCCGTGTACACCTTCGAGACCCTCCTGCACCAGGAGCTGGGGAAGGGGCCCACCAAGGAGGAGCTGTGCAAGTCCATCCAGAGGATCCTGGAGCGGGTGCTGAAGAAATATGACTATGACAGCAGCTCTGTGCGGAAGCGCTTCTTCCGAGAGGCATTGCTGCAGATCACGATCCCATTCTTGCTCAAGAAGCTGGCCCCCACCTGCAAGTCGGAGCTGCCCCGGTTCCAGGAGCTGATCTTCGAGGACTTCGCCAGGTTCATCCTGGTGGAGAACACGTACGAGGAGGTGGTGCTGCAGACGGTCATGAAGGACATCCTGCAGGCCGTGAAGGAGGCCGCTGTGCAGAGGAAGCACAACCTGTACCGGGACAGCATGGTCATGCACAACAGCGACCCCAACCTGCACCTGCTGGCCGAAGGCACGCCCATTGACTGGGGTGAGGAGTATGGCGATGGTGGTGGCAGTGGCGGCAGCAGTGGGAACAGCGGTGATCCCAGCCCCAGTGTCCCAGAAGCAGCCACCACCTCAGAGAAACAACGGCGTGCCAAGCAGGTGGTGTCCATGGTCCATGACGAGGCAGGGCTGCCCTTTGAGGCTGGCCCTGAGCTACTATCACCTGCATCCCTGGACAGTGTCACCGAGCTCCGTGGCCTGCTGGCCCAGGATCTGCGGGCTGAGAGCCCCCCGCCGGCCGGACCCCTGCTCAACGGGGCCCCTCTGCGGGAGAGCTCCCAGCCTGTGGCCACCCCCGAGGCCTCACCACCTGCCTCGCCCCTCCGGCAGCTCCCGCCTGGAAAGGCTGTGGACCTTGAACCTCCCAAGCCCAGTGACCAGGAGACCGGGGAGCAGGTGTCTAGCCCTGGTGGCCGCCCTGCCATCCACACTACCACCGAGGACAGTGCGGGGGTGCAGACTGAATTCTAGGCTGGTCGCCCCCGAGCTTCTGTTGGACAAGGCACATGGGCCCCTCCCTCCAAGGCACTGGCAGGCTTGGCTCCAGGCGGGAGTGCCAGATCTGTGTCTCCGGGTGGAGGTGGGGCAGGGCTAGTATGCGTCTGGGGCTGGGCAGGGACGGCCCACCTGAGTCACTTTATTGGGTTCGGTCATACTTTGTTGCTCCGTTTTCTTTTCTGTGGGCTGATCTCAGCTTTCCTCCTTGTGCTGGGGGCTGAGCAGAGATGAGGGGGCTGGGAAGCTCTCAGTGGCCCCGATTCTCTGGGTCCTCCCTTCCTGCCCTTCCTCCGTGGCCTGCCTCCCTCGTGGGTCTTGCCATCCTTGCAGAGGGAGGTAAAGGCTTTGTCTGCTGTGACTCAGCCCTTGAATTCTCTGCCCTCGCCAAGGGCTCATTGGAACTGGGAACATGTAGCGCTGAGGCCCATCTTGGTCGCACTCCCCTCCTGCTCTCCCTGGCTGGGCCCACTGGCCAGTGTCAGAGTGGACACTGGCCTCACCTTTCCGATCCCGGGTGAGGGGAGGTTCAAGGAGGGGGTCTTCGGGCTAGAGTCAGGCTGGGGGATGCTGGGGGAGGGGGTGCCTCATGAAGCAGGGTGGGGCCACAGGCCTGGGGATGGAGTAAGAACGGCCTGGAACGTGCTGGTCTGGGGAGAGGAAGTGTCAGAGGGCGGGCAGGAGCGAGCCCTGCCCAGGTGTTACTGGGGGCGGAGGTGTTACCGGGAGGATGTGCCAGCAGGGGGCGAGCGGGCAGAGGGAGCGGAGCTGGACGCCGAGCGGGCATTCGGGCCTCTCTCCCTCCCAGCCCCAGCTGCCGCTGCCCGCTTGCTCGCTGGGATCTAGTCCTCGGGAGTCCCTCCGTTGCCCCTGCCCCTTCTGTACCCACAGACTGTGCGGTGACTTGTTGCTCAGAGGCAGGGTTTAGTGGGTGCGGGTTCTGTCTTCTATGGGCCATCTCCACGGTACGCGCTGTCCACCAAGGGAGTTGGTGGGGCTCCTGAGGGGCCGCAGGTCCCCAAAGCACTGCTGGCAGCTTCTCGGAGGCTCTTAGGCTGTGGCTTGGCTCCTGCTGAGTTACCAAGTCACCTCATCCTGAAAATTCCAGGCCCCTTTTCAAAGCATGAGTCACCTAGGGCCCGGCCAACCTTCCTCAGCTTTTTAGTCCTAGGGGTGAGGGTCAAGCTGGGGCGACCCCAGCCCAGCACCTCCACACCCCTCCCCTTCTGCTTCAAGGGGAGGGCGGGCAGGGCAGAAACTGACTCCTTTGGAGTCCTCAGCGTGGGGCCCCCACCCCGCCCTGCATCCTCCGTCCCCTCGTACTTCCTGGGGCCCTGCCCTTGGACCCCAGGACGTGTGGCAGTGACTGGTGCTCAGGGCCCTCAGTCCCCACCAGCCCTAACCTCAAACGCCTCACTAACCTCTTCTACCAACATTCCGTCTTAAGACGCTGTCCTGTAGTGCCTTCTTTTGGGGTTTTCCAATCATCCTTCCCAGATATTGTATTAAAAATATTATGCAAACTGTTTAAGCTTTTACTAATCAATAAATGCTTTATTTAAAGCCAGTGGCCTGTGTGTCATGCCAGCAGGGGGAGACCTGGGCTGGAGGCTGTTTAGGAGGCCCGTGTACCCTGGCTTTCTGCGATCATCTGACCGAGTACCTAGAGGTCAGAGTTCTTAGAGTATCCCATTTCACAGAGGTGGAGACCAAGGCTGAGCGAGAGGATACAGAGCATGCAGGTGACCGGCCTGTCAGCAGCTCAGGCAGCTTCCTCAGCTAGACCTGCGCAGGGCGCTCCTCATGCCACCTCGGGTGACAGTGAGGCCAGGAGGTTCACCTGCTTCTTGCTGTTGGCCTCGGCAAGTCACTAACAGCCTCGGGGGCCTCATCTATAAAAGGGAAGTCATCGAAGTCCTTTCTCCCAGGGCCTCGTGAAGATTCAGGGAGAGTCTCTGAGAAACGCGGTGCTCTGCAGAGTCCCTGCCCACCGCAGGCCTCAGTCTCCCCTCATGACCAAGGGGAGCCCAGAAGGGCAAGGAGAGGGAACCGTCAAAGGTCACCAGGGGGCAGAGGACAGTGGGGGAAGAGGCCCCAGCTCCTGCCTGGAAAGCAG