Transcript asmbl_25462

Sequence
Transcript Sequence for observation asmbl_25462 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGGTACTTTCCCCACCCGATACCTTATCCACTTGAGTTGTGAGGGGAAAAAATGGAGAAAGGATTTAAGCCACATTGGTTTCATGGCAGCAAAGCATCCAGATCGGCCACCCATTAACATTGGATACAGGACATTGGTCCAAGCTTTCACAGGTGTCTTGGGGTTTGCGCACAGTCGGAACTGACCCTGGACTAGGCCTTGCTTCTTGCGCCTCCAGTGAGTCCCCTTCATCCCATCACAAAATGAGCAAAGGAAAAATCCTCCCAACTCCTGTAACTTTCTGTCCTCGTCTGCTCACACAGCGGCGACGGAAATGCCCCACCAAGGAGGCCCCACCTCACTGCTCCCGGTTGGTCCTGGGTTCCCTCAGTGGCTTTCTGAATGTAAATAAGGGCCAGAGGCCTTAGAAGATGGAAGTGTTTTTCTATATATTAGAAGTATTTTTTGATAAATTATATATTTTCCTTCCTAGCTGAAGTGTGACTGCCTGTGTGTGACTAACTGAGCCACAGCGCAGCCACCCCACACTCTGTTTGCCCACAGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTA