Transcript asmbl_44299

Sequence
Transcript Sequence for observation asmbl_44299 of TGE0005816:
CAGGATTCTTTTGTAGAACTCTCTCTTGGAATGATATTTTCATCATGAGCCAACAAGGTTATGTGGCGACACCACCCTATTCTCAGTCCCAGTCTGGGATGGGCCTTTCTCCACCGCATTACGGACACTATGGGGACCCGTCTCATGCAGCTCCTCCCCCAGGCATGATGAAGCCGGCAGGGCCTCTGGGGGCCGCTGCACCAGGGGCGATGTCACCACAGGGCCCTCCACCTCCTGGACCCCATCAGTTCAGCCAGAACGGAGCGCACGCCCAGGGTCACCCTTCCCAAAGATTTCCAGGACCTCCACCTGTCAACAGTGCAGCACCCTCATATGCACCGTATTCACCTGCCACACAGTCATCTTACGCAAGCCCCATGCCCGCCCCATCCGTCTCCCAGCTGGGCAGTCAGCTCGGTGCCGTGCACATCAACAGCTATGGTAACCAGTCAGGTCCAGCCCCCTCCAGCCAGGGCCCCCCGGGCCCTCCGTCAGCGCCATCATTCCAGGGCCCTCCACAGCCACCGCCACCATCCATCCTGCAGCCTGGGCCTCAAGTCCTTCCGCCACCACCCACTGCGCTCAATGGCCCAGGGGCGCCACCCCTGCCTCCGCCCACGCACAGGCAGGACGGGCTCGCTGGGCCCGCTCCCGCGAGGGCCCCGCTGCAGCCCCCACCTCTCCTGGGACAGGCTGTGGCCGCCGGCTACCCTCCGCAGCCAGCCAACTACAGCCCACAGATGCCAGGGGCGCAGCTCTCGTTCCCAGGAGGCTTCCCTGCAGGGCCCGCACAGATGGCAGGGCCACCTCCGCCCCAGAAGAAGCTGGACCCTGACTCTATCCCCAGTCCAATCCAGGTGATCGAGAATGACAGAGCTGCCAGAGGGGGACAAGTGTACGCCACCAATACCAGAGGCCAGGTCCCTCCCCTGGTCACCACAGACTGTGTGGTCCAAGACCAAGGCAACGCTAGTCCTCGGTACATTCGCTGCACGACGTACTGCTTCCCGTGCACGTCCGACATGGCCAAGCAAGCGCAGATCCCGCTAGCCGCGGTCATCACGCCCTTCGCCACCATTCCTTCAAATGAGACTCCCCTTTACTTGGTGAACCATGGAGAGACCGGGCCGGTCAGGTGCAACAGGTGCAAAGCCTACATGTGCCCGTTCATGCAGTTCATAGAGGGAGGACGGAGGTTCCAGTGTGGCTTCTGCAACTGCGTGAGCGACGTCCCGCCGTTCTATTTCCAACATCTGGACCACATGGGAAGAAGACTGGACCACTACGAGAAGCCGGAGTTATCTCTAGGATCTTACGAATACGTTGCTACTTTGGATTACTGCAGAAAGAGTAAGCCTCCCAGCCCGCCCGCCTTCATCTTCATGATCGACGTCTCCTACAGCAACATCAAGAACGGGCTCGTGAAGCTCATATGCGAGGAGCTGAAGACCGTGCTGGACAAGCTGCCCAAGGAAGAGCAGGAAGAGACTTCTGCCATCCGCGTCGGCTTCGTCACATACAACAAGGCCCTCCATTTCTTCAATGTCAAGAGTAATTTGGCCCAGCCTCAGATGATGGTGGTGACCGACGTGAGCGAGGTCTTCGTCCCTTTGCTGGATGGTTTCCTTGTCAACTATCAAGAATCCCAATCTGTGATTCACAATTTGCTGGACCAGATTCCCGAGATGTTCGCGGACTCCGCTGAGAACGAGACTGTCTTTGCCCCTGTCGTCCGGGCCGGCATGGAGGCCCTGAAGGCGGCGGACTGCCCCGGGAAGCTGTTCGTCTTCCACGCCTCGCTGCCCACCGCCGAGGCCCCGGGGAAGCTGAAGCCCAGGGACGACAGGAAGCTGGTGAACACGGACAAAGAGAAGATGCTGTTCCAGCCCCAGACCAGCGTCTACGACTCGCTGGCCAAGGACTGCGTGGCCCGGCTGCTCCTTTTTTTTTCCCAGTCAGCACGTGGACGTGGCCTCCCTGGGCCTCGTGCCCCATCTCACTGGAGGGACCCTTTACAAGTACAGCAACTTCCAGATGCACTTGGATAGCCAGCAATTCTTGAATGACCTCAGAAATGATATTGGGAAGAAAATAGGATTTGACGCCATAATGCGGGTCCGCACCAGCACAGGATTTAGAGCCACTGATTTCTTTGGCGGAATTTTTATGAACAACACCACCGATGTGGAGATGGCGGCCATCGATTGTGACAAGGCAGTGACTGTGGAGTTTAAGCACGATGACAAACTTAGTGAAGACAGTGGGGCCTTAATCCAGTGCGCTGTGCTTTACACGACCGTCGGCGGTCAGAGGAGACTGCGGATTCACAACCTTGGCCTGAACTGCAGCGCCCAGCTGGCCGACCTCTATAAGAGCTGTGAGACGGACGCCCTCATCAACTTCTTCGCCAAGTCAGCTTTCAAAGCAGTCCTGCACCAGCCCTTGAAGGTCATCCGGGAAATTCTCGTTAACCAGACCGCCCACATGTTGGCCTGCTACCGGAAGAACTGTGCCAGCCCATCCGCAGCCAGCCAGCTCATTCTGCCGGATGCCATGAAGGTGCTGCCCGTGTACATGAACTGCTTGCTGAAGACCTGCGTGCTGCTCGGCCGGCCGGACGTCGCGGTGGACGAGCGCGCCTTCCAGCGCCAGCTGGTCCTGACCATGGGTGTGGCCGACTCGCAGCTCTTCTTCTACCCGCAGCTCCTGCCCATCCACACGTTAGACGTCACGAGCACGGCAGTGCCCGCTGCCATTCGCTGCTCCGAGTCGCGCCTTTCGGAGGACGGAGTGTTCCTGCTGGTGAACGGCCTGAACGTGTTCCTGTGGCTGGGCGCCAGCAGCCCGCCCGAGCTCATCCAGGGGATATTCAGCGTGCCGTCGCTGGCACACGTCAGCACAGACATGACGTTACTGCCTGAGGTAGGAAACCCGTATTCTCAAACACTCAGGACAATAATGAGTACCATCCAACAAAAGAGGCCATATTCAATGAAGCTCGTGATCGTAAAGCAGCGAGAACAGGCAGAAATGCTCTTCCGGCAGCTCCTGGTGGAGGACAAGGGACCCCACGGAGGGCCGTCTTACGTGGATTTCCTCTGCTGTGTGCACAAGGAGATCTGTCAGCTGCTGAATTAGCGGAGCCTTCTGTGTTGGCGTTGCGTTTCTAGGGAAATCATCTCCTTCTTGGCGGCTGATTCTCCAGATGACAGCGGGCTCGCTTTGATTCCTTGCTCCTTTTCAGAGTGGCTTTCCACAGCATTCAGACCTTCAGCTTTGGTGCTCAGGTGCGAAGCCAGCGAAGGGACAGCTGTACCTCAAAGGGAACAGTCTGTTTCTATTGTACAATTTTTAACTGTTAAGACTGATGATATACTTTTGCATTTCATGAAAGGCACAGTTTTACAAAACTGTAAACATTCTCAATTTTCCTTCTTTGTGCCAGACATTTAAATTATTTTTCAAAATGTATAGATTTGGGGAAAAGGTTGTCTTGGCTCATCTCCTATTTGCAGTGAGAGGAAAAAAACTTAATTTTTACATTATATCTAATTTTTTTAAACCACGTAACCCCACTGAACATTTTCCACTTGAGGTTTGCATAGCGGACTTTTAATAACCTTGGAATCTATTGGTAGGACCATGTGCGTTCTACATTTTTTTCATAATTCTATGTTGTGTATGTTAAACTATTTTCCGATTGTCTATAAAATTGTCTATCAATACTCTCAAATGGTTCTCTGTACAATAATGAAGGTTTCTACCTGTATATAATGGATCTTAACCAGTATCAATAAATCCCTTCG